Dataset for CDS BCL2L11 of organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A667H9R7_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A667H9R7_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A667H9R7_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A667H9R7_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A667H9R7_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A667H9R7_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
                        **************************************************

A0A667H9R7_BCL2L11      cctctctacagaccgagcagcaag--------------------------
A0A667H9R7_BCL2L11      cctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A667H9R7_BCL2L11      cctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A667H9R7_BCL2L11      cctctctacagaccgagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A667H9R7_BCL2L11      cctctctacagaccgagcagca----------------------------
                        **********************                            

A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A667H9R7_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A667H9R7_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A667H9R7_BCL2L11      --------------------------------------------------
                                                                          

A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A667H9R7_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A667H9R7_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A667H9R7_BCL2L11      --------------------------------------------------
                                                                          

A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A667H9R7_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A667H9R7_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A667H9R7_BCL2L11      ----------------------------------------agacaggagc
                                                                          

A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A667H9R7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A667H9R7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A667H9R7_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                                                                          

A0A667H9R7_BCL2L11      --------------------------------cttccatgaggcagcctc
A0A667H9R7_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A667H9R7_BCL2L11      ccaggccttcaaccattatctcagtgcaat--------------------
A0A667H9R7_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A667H9R7_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
                                                                          

A0A667H9R7_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A667H9R7_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A667H9R7_BCL2L11      --------------------------------------------------
A0A667H9R7_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A667H9R7_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
                                                                          

A0A667H9R7_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----ctg
A0A667H9R7_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----tta
A0A667H9R7_BCL2L11      ----------------------------------------gggtcttttt
A0A667H9R7_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
A0A667H9R7_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
                                                                **      * 

A0A667H9R7_BCL2L11      gcaagagtaccg--------------------------------------
A0A667H9R7_BCL2L11      gagcaatag-----------------------------------------
A0A667H9R7_BCL2L11      gaataa--------------------------------------------
A0A667H9R7_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac
A0A667H9R7_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac
                        *    *                                            

A0A667H9R7_BCL2L11      ---------gcatcctacatctga-----------------
A0A667H9R7_BCL2L11      -----------------------------------------
A0A667H9R7_BCL2L11      -----------------------------------------
A0A667H9R7_BCL2L11      tgttacgttacatcgtccgcctggtatggcgattgcagtga
A0A667H9R7_BCL2L11      tgttacgttacatcgtccgcctggtatggcgattgcagtga
                                                                 

© 1998-2020Legal notice