Dataset for CDS classical BH3-containing proteins of organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5QUK0_BAD-01       ------------atggc-------aggttctgtgccggat----------
A0A8C5QSK2_BCL2L11      ------------atggc-caaacaaccatcagtgttgagtccggacagtg
A0A8C5R6G2_BMF-01       atgagttacaggatggagcaggagagcttc----ctaagttcagac---g
A0A8C5R6G2_BMF-02       ------------atggagcaggagagcttc----ctaagttcagac---g
                                    ****        *   **         *          

A0A8C5QUK0_BAD-01       ---------------accattttcagcatagaaa---------------a
A0A8C5QSK2_BCL2L11      agagtggagacactgacaatcttcagtcgacaagtagtagacccactcca
A0A8C5R6G2_BMF-01       agctggacgacgatg----tgttctatccggatg----------actttg
A0A8C5R6G2_BMF-02       agctggacgacgatg----tgttctatccggatg----------actttg
                                           * ***       *                  

A0A8C5QUK0_BAD-01       atttgactctgatgaacaagg-------tgtctttcactctagct-----
A0A8C5QSK2_BCL2L11      cactgccccctcagaagaggggcccccacatccctcaattccccttttca
A0A8C5R6G2_BMF-01       aattctcgcttc----------------cacccttgactccaccttct--
A0A8C5R6G2_BMF-02       aattctcgcttc----------------cacccttgactccaccttct--
                           *  * *                      *  * * *    **     

A0A8C5QUK0_BAD-01       ---cagatcctccc------------------------------------
A0A8C5QSK2_BCL2L11      aggcagtctttccaatgagggggggagctcctcagccagcactccgtggg
A0A8C5R6G2_BMF-01       ---ccgttcatcca---------gaagtatactagt---ttcttcgggag
A0A8C5R6G2_BMF-02       ---ccgttcatcca---------gaagtatactagt---ttcttcgggag
                           * *    ***                                     

A0A8C5QUK0_BAD-01       ---tctacatccacctgcaaagtatcaaggagttcacc------------
A0A8C5QSK2_BCL2L11      gtacctctataccgccgtatagccccaattcaatcaccagcagatccccg
A0A8C5R6G2_BMF-01       gttccaccttttccctctgtctcactgctgtggtc-----caggatgtag
A0A8C5R6G2_BMF-02       gttccaccttttccctctgtctcactgctgtggtc-----caggatgtag
                            *    *    *                  **               

A0A8C5QUK0_BAD-01       -----caatctgcagagacaaagaggaaagg---------------aggc
A0A8C5QSK2_BCL2L11      cattgcatgctcctgaga-------agacagtctcttgtctctagcggtt
A0A8C5R6G2_BMF-01       gagcgcagactccgaagacaaggccacacagacacttg--------ggtc
A0A8C5R6G2_BMF-02       gagcgcagactccgaagacaaggccacacagacacttg--------ggtc
                             **  ** *  ***         *  *                *  

A0A8C5QUK0_BAD-01       acgattt------cgt-------------------------acagagtct
A0A8C5QSK2_BCL2L11      acttctcgtttgacatta--gccctgcacctctgagctgtgataaagcca
A0A8C5R6G2_BMF-01       accatctgtaag-catgaacgccatgttgccttgtggggtcacggaatcc
A0A8C5R6G2_BMF-02       accatctgtaag-catgaacgccatgttgccttgtggggtcacggaatcc
                        **           * *                         *   *  * 

A0A8C5QUK0_BAD-01       gcttcagagccagttaca-----------gagacagatcacgtagccgag
A0A8C5QSK2_BCL2L11      -ctcaaacgccaagcccac--------------cttgccaggccgtcaac
A0A8C5R6G2_BMF-01       -ccccaaagacttttctatggtaatgcaggatacatgttacagcatcccg
A0A8C5R6G2_BMF-02       -ccccaaagacttttctatggtaatgcaggatacatgttacagcatcccg
                         *   *  * *      *               *     *      *   

A0A8C5QUK0_BAD-01       ctccgttaccggtcacgttc-----ccgttctgccccct-----------
A0A8C5QSK2_BCL2L11      caccttctatcagcaatggcagctgccagacatcccatcgaactccacaa
A0A8C5R6G2_BMF-01       cgcgctccccaagcttgctcagagaccatttgactcgcggaaggcaggag
A0A8C5R6G2_BMF-02       cgcgctccccaagcttgctcagagaccatttgactcgcggaaggcaggag
                        * *  *       *     *     **      * *              

A0A8C5QUK0_BAD-01       cttcagttctggttgct-gctcgttatggacgagaactgaggcgtatgag
A0A8C5QSK2_BCL2L11      tatgagtcctgaaatctggatcgc-----acatgagcttcgtcgcatcgg
A0A8C5R6G2_BMF-01       ca-gagtgctgagcgccggatcgc-----gcgcaaactacaatgtatcgg
A0A8C5R6G2_BMF-02       ca-gagtgctgagcgccggatcgc-----gcgcaaactacaatgtatcgg
                            *** ***    *  * ***       *   * **     * **  *

A0A8C5QUK0_BAD-01       tgacgaatttga----ccttacgtttacgggccttcctcgtccaa--aaa
A0A8C5QSK2_BCL2L11      agatgagtttaatgcagcgtttgctcacagacgggggttccccaacaaca
A0A8C5R6G2_BMF-01       agatcagtttca--caggcttcatttacaaaag------cttcaa-----
A0A8C5R6G2_BMF-02       agatcagtttca--caggcttcatttacaaaag------cttcaa-----
                         **  * *** *       *    * **              ***     

A0A8C5QUK0_BAD-01       gtgcaggtgcagcaagtgagatgacagaaagtaagagttttaaagaaatg
A0A8C5QSK2_BCL2L11      gacccagagcagcagagcaggtg---gtaatcctgcgtgtt------ttg
A0A8C5R6G2_BMF-01       ----cagaacag-aaatcaagtt---tggtctcagatcttc------ttc
A0A8C5R6G2_BMF-02       ----cagaacag-aaatcaagtt---tggtctcagatcttc------ttc
                              *  *** *    *  *            *    *        * 

A0A8C5QUK0_BAD-01       tttatgagtttttggggacgccggaaaagtaaagggaagcctgactctac
A0A8C5QSK2_BCL2L11      cgtttcctcgttcgattgatttgga-------------ggatgc------
A0A8C5R6G2_BMF-01       tttttccgcaacctggtgatccaaaacgagagaaacaggggtga------
A0A8C5R6G2_BMF-02       tttttccgcaacctggtgatccaaaacgagagaaacaggggtga------
                          * *                   *             *  **       

A0A8C5QUK0_BAD-01       tgatgaaacctc-ataa
A0A8C5QSK2_BCL2L11      -agtga-----------
A0A8C5R6G2_BMF-01       -ggtgaactggcgatga
A0A8C5R6G2_BMF-02       -ggtgaactggcgatga
                           ***           

© 1998-2022Legal notice