Dataset for CDS BCL2L11 of organism Laticauda laticaudata

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5STS5_BCL2L11      atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtgg
A0A8C5STS5_BCL2L11      atggcaaaacaatctcctgatttaaattctgagtgtgagagagaaggtgg
                        **************************************************

A0A8C5STS5_BCL2L11      acaattgcagcctgctgaaaggccagctcagcctcatcaccttcggcctg
A0A8C5STS5_BCL2L11      acaattgcagcctgctgaaaggccagctcagcctcatcaccttcggcctg
                        **************************************************

A0A8C5STS5_BCL2L11      gggcccctacctccttacaaactgaatatcaaggtaatcatttgggtgaa
A0A8C5STS5_BCL2L11      gggcccctacctccttacaaactgaatatcaaggtaatcatttgggtgaa
                        **************************************************

A0A8C5STS5_BCL2L11      cgggacagttcatcacccggtagccctcagggaccactggcaccaccctc
A0A8C5STS5_BCL2L11      cgggacagttcatcacccggtagccctcagggaccactggcaccaccctc
                        **************************************************

A0A8C5STS5_BCL2L11      cagtcccagtccatttgcaaccagatccccgttgttcatgtttgtaagaa
A0A8C5STS5_BCL2L11      cagtcccagtccatttgcaaccagatccccgttgttcatgtttgtaagaa
                        **************************************************

A0A8C5STS5_BCL2L11      gatccccactgctgtccagatcctccagtgggtatttctcttttgacatc
A0A8C5STS5_BCL2L11      gatccccactgctgtccagatcctccagtgggtatttctcttttgacatc
                        **************************************************

A0A8C5STS5_BCL2L11      gacaggagtcctgcacctatgaattgtgacaaagcaacacagactccaag
A0A8C5STS5_BCL2L11      gacaggagtcctgcacctatgaattgtgacaaagcaacacagactccaag
                        **************************************************

A0A8C5STS5_BCL2L11      tccgccctgtcaagctatcaatcattatctaagtgcaatgggtaagcaag
A0A8C5STS5_BCL2L11      tccgccctgtcaagctatcaatcattatctaagtgcaatgggtaagcaag
                        **************************************************

A0A8C5STS5_BCL2L11      agcatgcttccagatggcagtcacggcctatacctgaggatatgcagcca
A0A8C5STS5_BCL2L11      agcatgcttccagatggcagtcacggcctatacctgaggatatgcagcca
                        **************************************************

A0A8C5STS5_BCL2L11      gaaatatggattgcacaggaattacggcgtattggagatgaatttaatgc
A0A8C5STS5_BCL2L11      gaaatatggattgcacaggaattacggcgtattggagatgaatttaatgc
                        **************************************************

A0A8C5STS5_BCL2L11      ttcctactgtccaagaaggg-------------gtttattggattaccag
A0A8C5STS5_BCL2L11      ttcctactgtccaagaagggtaactttcaacatttttattgtttta----
                        ********************              *******  ***    

A0A8C5STS5_BCL2L11      ggagtaaatcaccagatcat-----------aattttg-cgccttttgca
A0A8C5STS5_BCL2L11      -----aattcttttgcttattccagtgatggagctctgtcgacttataca
                             ** **    * * **           *  * ** ** *** * **

A0A8C5STS5_BCL2L11      ---------ttatatcgtccgcttcatatggagaatgcagtga-------
A0A8C5STS5_BCL2L11      aaggacaggggaaagcaaatgttacatctcgaacatttgctaaattactg
                                   * * *    * * *** * **  **    * *       

A0A8C5STS5_BCL2L11      -
A0A8C5STS5_BCL2L11      g
                         

© 1998-2022Legal notice