Dataset for CDS BCL2L11 of organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W6ETK4_BCL2L11      atgaa---------------------------------------------
A0A4W6ETK4_BCL2L11      atgtatatatatatatgtatatgtacatataaatatatcacagacagctt
A0A4W6ETK4_BCL2L11      --------------------------------------------------
                                                                          

A0A4W6ETK4_BCL2L11      -------------------agcccaggctgacggtgccgctctgttcatc
A0A4W6ETK4_BCL2L11      gacatcgtgttattctcggagccagcggttatgtcgcgccactg-acatg
A0A4W6ETK4_BCL2L11      --------------------------------------------------
                                                                          

A0A4W6ETK4_BCL2L11      caa--------cagaccaccaaaccagtccgatggctcgaccgaagtaac
A0A4W6ETK4_BCL2L11      caacctccgtccagaccaccaaaccagtccgatggctcgaccgaagtaac
A0A4W6ETK4_BCL2L11      caa---------agaccaccaaaccagtccgatggctcgaccgaagtaac
                        ***         **************************************

A0A4W6ETK4_BCL2L11      ggcaagagaggagagcggaggagatccacacgtcgacggtgccgctggag
A0A4W6ETK4_BCL2L11      ggcaagagaggagagcggaggagatccacacgtcgacggtgccgctggag
A0A4W6ETK4_BCL2L11      ggcaagagaggagagcggaggagatccacacgtcgacggtgccgctggag
                        **************************************************

A0A4W6ETK4_BCL2L11      cctcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcgg
A0A4W6ETK4_BCL2L11      cctcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcgg
A0A4W6ETK4_BCL2L11      cctcggcgcaaacgtcccgttcgaacgacggcggcggcggcggcgagcgg
                        **************************************************

A0A4W6ETK4_BCL2L11      agctttggccaccgcggctccaccggaggaggagagctggcggactcgcc
A0A4W6ETK4_BCL2L11      agctttggccaccgcggctccaccggaggaggagagctggcggactcgcc
A0A4W6ETK4_BCL2L11      agctttggccaccgcggctccaccggaggaggagagctggcggactcgcc
                        **************************************************

A0A4W6ETK4_BCL2L11      gccccggt-------------------------------cctaggcgtgt
A0A4W6ETK4_BCL2L11      gccccggtgcagaaccaaagccatctcccctctcgacagcctaggcgtgt
A0A4W6ETK4_BCL2L11      gccccggtgcagaaccaaagccatctcccctctcgacagcctaggcgtgt
                        ********                               ***********

A0A4W6ETK4_BCL2L11      ttcagaagaggtctatattcagctaccctcgccgctcctccagtggatat
A0A4W6ETK4_BCL2L11      ttcagaagaggtctatattcagctaccctcgccgctcctccagtggatat
A0A4W6ETK4_BCL2L11      ttcagaagaggtctatattcagctaccctcgccgctcctccagtggatat
                        **************************************************

A0A4W6ETK4_BCL2L11      ttctccttcgacggcgagtcgctgccgagctccccgctctccccgaggcc
A0A4W6ETK4_BCL2L11      ttctccttcgacggcgagtcgctgccgagctccccgctctccccgaggcc
A0A4W6ETK4_BCL2L11      ttctccttcgacggcgagtcgctgccgagctccccgctctccccgaggcc
                        **************************************************

A0A4W6ETK4_BCL2L11      agcgacggctgacagagccacgcagactccgagccccaccagccaggtga
A0A4W6ETK4_BCL2L11      agcgacggctgacagagccacgcagactccgagccccaccagccaggtga
A0A4W6ETK4_BCL2L11      agcgacggctgacagagccacgcagactccgagccccaccagccaggtga
                        **************************************************

A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggaccgggg
A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggaccgggg
A0A4W6ETK4_BCL2L11      tgaaacacttcttgcagcgcatgaccgaggcgcacggcagaggaccgggg
                        **************************************************

A0A4W6ETK4_BCL2L11      acgcagcagctgcacgttgacaccccagtgctcctcctctctcccaaccc
A0A4W6ETK4_BCL2L11      acgcagcagctgcacggaag------------------ctctcccaaccc
A0A4W6ETK4_BCL2L11      acgcagcagctgcacggaag------------------ctctcccaaccc
                        ****************                      ************

A0A4W6ETK4_BCL2L11      ctctagcacacagcaacgcaacgcagcaggggacatgcagacggaggcag
A0A4W6ETK4_BCL2L11      ctctagcacacagcaacgcaacgcagcaggggacatgcagacggaggcag
A0A4W6ETK4_BCL2L11      ctctagcacacagcaacgcaacgcagcaggggacatgcagacggaggcag
                        **************************************************

A0A4W6ETK4_BCL2L11      taatcggacaagagctccgacgcattggggacgatttcaacagactcctt
A0A4W6ETK4_BCL2L11      taatcggacaagagctccgacgcattggggacgatttcaacagactcctt
A0A4W6ETK4_BCL2L11      taatcggacaagagctccgacgcattggggacgatttcaacagactcctt
                        **************************************************

A0A4W6ETK4_BCL2L11      ctgttaaggg--------------------ttagtcatca----------
A0A4W6ETK4_BCL2L11      ctgttaaggggggtggcaggtggacatagaccagttgtgatccctcagca
A0A4W6ETK4_BCL2L11      ctgttaaggggggtggcaggtggacatagaccagttgtgatccctcagca
                        **********                      ***  * *          

A0A4W6ETK4_BCL2L11      -------------------cagg----cactgtgtgtgtgtgtgtgtgtg
A0A4W6ETK4_BCL2L11      gcagctgccgcacatccaccaggagcccaccgtgctgttgtgtgtgggca
A0A4W6ETK4_BCL2L11      gcagctgccgcacatccaccaggagcccaccgtgctgttgtgtgtgggca
                                           ****    *** ***    ******** *  

A0A4W6ETK4_BCL2L11      tgtttgtgtgtgtgtgtgtgtgtgtg--------ggagggggggttga--
A0A4W6ETK4_BCL2L11      tcctgctccttgtgattggacggataatctacttgcaaggcggtatgaac
A0A4W6ETK4_BCL2L11      tcctgctccttgtgattggacggataatctacttgcaaggcggtatgaac
                        *  *  *   ****  **   *  *         * * ** **  ***  

A0A4W6ETK4_BCL2L11      ------------------------
A0A4W6ETK4_BCL2L11      aaccaggaccacgctcaggtctag
A0A4W6ETK4_BCL2L11      aaccaggaccacgctcaggtctag
                                                

© 1998-2020Legal notice