Dataset for CDS classical BH3-containing proteins of organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2ZA20_BMF-01       atggacgatgag----------gaggatgatgtgtttgagccagatccca
A0A3Q3AEL8_BAD-01       atggctgcaaagttcaccatttcagacag-cgagtcggagc----cctca
A0A3Q3AEL8_BAD-02       atggctgcaaagttcaccatttcagacag-cgagtcggagc----cctca
A0A3Q3B113_BCL2L11      a----tgcgtagtccatc----cagaccgccaaatctgcgcgatggctcg
                        *     *   **           **   *     *  * **     * * 

A0A3Q2ZA20_BMF-01       gctgctggcgcacgactttcagggagataaagtgcgaa------------
A0A3Q3AEL8_BAD-01       gacgagg-----------tagaggagggaaagagcaaacagccggcagcg
A0A3Q3AEL8_BAD-02       gacgagg-----------tagaggagggaaagagcaaacagccggcagcg
A0A3Q3B113_BCL2L11      accgaag-----------taaagg-----------caacagagggcagca
                           *  *           *   **            **            

A0A3Q2ZA20_BMF-01       -gaccggggca----cacagacacccggt---------------------
A0A3Q3AEL8_BAD-01       ggaccggagga----cggcgtccgccagcgcctcac--------------
A0A3Q3AEL8_BAD-02       ggaccggagga----cggcgtccgccagcgcctcac--------------
A0A3Q3B113_BCL2L11      g---cggaggagctccaccgtccgccggcgccgctcgaggctcggcgcac
                            *** * *    *   * *  ** *                      

A0A3Q2ZA20_BMF-01       ----cctgccctggtac-------cacacagcggcatgctgccctgtg--
A0A3Q3AEL8_BAD-01       ----cctgcccgagctcaggcattcaaagaacggccggc-tcagggtga-
A0A3Q3AEL8_BAD-02       ----cctgcccgagctcaggcattcaaagaacggccggc-tcagggtga-
A0A3Q3B113_BCL2L11      gcgacccgtccggtccgcggc------agagcgccgagc-gccgcgggag
                            ** * **                * * ** *  **  *   * *  

A0A3Q2ZA20_BMF-01       --------gagtcgcagaggagcccagaccactattctacggt-------
A0A3Q3AEL8_BAD-01       ---actcggagtcgct------ctcctccaccagctccagggg-------
A0A3Q3AEL8_BAD-02       ---actcggagtcgct------ctcctccaccagctccagggg-------
A0A3Q3B113_BCL2L11      gagagcccgagtcgccggcctgctcctccaacccccccgctggcttagac
                                *******       * *   *  *    *    *        

A0A3Q2ZA20_BMF-01       -------aacgcaggttttcgatt-gcacttcccagctc-----------
A0A3Q3AEL8_BAD-01       -------ggaggagg------------agctcccggcgc-----------
A0A3Q3AEL8_BAD-02       -------ggaggagg------------agctcccggcgc-----------
A0A3Q3B113_BCL2L11      gtgtttcggagcaggtcgatatttcgcttcccccggcgctcgtccagcgg
                                  * ***                *** ** *           

A0A3Q2ZA20_BMF-01       --------------------------------gcttcgaactc-------
A0A3Q3AEL8_BAD-01       ---------------gggca----gacgacgagcccgggacccccaccga
A0A3Q3AEL8_BAD-02       ---------------gggca----gacgacgagcccgggacccccaccga
A0A3Q3B113_BCL2L11      ctacttctctttcgagggcgactcgctgccgagctctccgctctcgccga
                                                        **      * *       

A0A3Q2ZA20_BMF-01       -atcagggatcttgaagcgaggcaacaaga--------------------
A0A3Q3AEL8_BAD-01       gg--ggtatccgttcagggggcgatccaag---tcggcccctccagccct
A0A3Q3AEL8_BAD-02       gg--ggtatccgttcagggggcgatccaag---tcggcccctccagccct
A0A3Q3B113_BCL2L11      agccagtgacggcggagaaagccacgcagacgcccagccccaccggccag
                             *         **   *  *   *                      

A0A3Q2ZA20_BMF-01       ------------------------------------cagggaagagg---
A0A3Q3AEL8_BAD-01       gtg-----------------------ggccgc----caagaagtacggcc
A0A3Q3AEL8_BAD-02       gtg-----------------------ggccgc----caagaagtacggcc
A0A3Q3B113_BCL2L11      gtgatgaaccacgccctgcagcgaatggctgtggagcagggaggaggacc
                                                            ** * *  * *   

A0A3Q2ZA20_BMF-01       ---agccaaacaggatggagcggctgccccggcagctgcc----------
A0A3Q3AEL8_BAD-01       ggcagctccgccggat-gagcgacgagttcgacagcct------------
A0A3Q3AEL8_BAD-02       ggcagctccgccggat-gagcgacgagttcgacagcct------------
A0A3Q3B113_BCL2L11      gg-ggacgcaccggct-gcacggaagctctcccaacccctctggcacgca
                            *     * ** * *  **          ** *              

A0A3Q2ZA20_BMF-01       --cgtggcgcgcagcttgga----------agtttgtattggacagaaac
A0A3Q3AEL8_BAD-01       --------gctcgacaaggg------------------------------
A0A3Q3AEL8_BAD-02       --------gctcgacaaggg------------------------------
A0A3Q3B113_BCL2L11      ggcacgaaacgcagcaggggacatggaggcagagtcattcggacgtcatc
                                 * *  *  **                               

A0A3Q2ZA20_BMF-01       tccagctgataggagaccagttt-------------------------ca
A0A3Q3AEL8_BAD-01       -----------ggagatgaggaaggt----------------gaagagcg
A0A3Q3AEL8_BAD-02       -----------ggagatgaggaaggt----------------gaagagcg
A0A3Q3B113_BCL2L11      tccggaccattggggatgagtacaataggcttttacttttaaggaggatg
                                   ** **  **                              

A0A3Q2ZA20_BMF-01       ccgggaacactt-gcagcagtatca-----tcgaaaccaaaggaac----
A0A3Q3AEL8_BAD-01       ccgggacgaccaaacagatacaccactc--ccgaagctggtggaactacc
A0A3Q3AEL8_BAD-02       ccgggacgaccaaacagatacaccactc--ccgaagctggtggaactacc
A0A3Q3B113_BCL2L11      gcaggccgacccagacgaaacatcgttcctctgaacctcctgccac-aca
                         * **   **      *    * *        *** *    *  **    

A0A3Q2ZA20_BMF-01       -----------caggggccgctgtggtggcgcctgactgcagctctcctc
A0A3Q3AEL8_BAD-01       tctttagtcaccaggagacg--gacg---------gcgagagc-agccac
A0A3Q3AEL8_BAD-02       tctttagtcaccaggagacg--gacg---------gcgagagc-agccac
A0A3Q3B113_BCL2L11      tc------caccaggagcct--gtcgccatgctctgcgtgagc-ctcctg
                                   **** * *   *  *          *   ***   **  

A0A3Q2ZA20_BMF-01       agccttctgtttgatagggggttca-------------ttgcgggaggag
A0A3Q3AEL8_BAD-01       cac-----g---agaagccgaccca-------------ccgca-------
A0A3Q3AEL8_BAD-02       cac-----g---agaagccgaccca-------------ccgca-------
A0A3Q3B113_BCL2L11      ctcctcctg---attggacggctcatgtacttacaaggctgcacaaacag
                          *     *       *  *   **               **        

A0A3Q2ZA20_BMF-01       ggggtgcaggacggaggtga--
A0A3Q3AEL8_BAD-01       -ccgagtaa-------------
A0A3Q3AEL8_BAD-02       -ccgagtaa-------------
A0A3Q3B113_BCL2L11      ccagaataattctcaggtttag
                           *   *              

© 1998-2022Legal notice