Dataset for CDS BAD of organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q3AEL8_BAD-01      atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacga
A0A3Q3AEL8_BAD-02      atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacga

A0A3Q3AEL8_BAD-01      ggtagaggagggaaagagcaaacagccggcagcgggaccggaggacggcg
A0A3Q3AEL8_BAD-02      ggtagaggagggaaagagcaaacagccggcagcgggaccggaggacggcg

A0A3Q3AEL8_BAD-01      tccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccgg
A0A3Q3AEL8_BAD-02      tccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccgg

A0A3Q3AEL8_BAD-01      ctcagggtgaactcggagtcgctctcctccaccagctccaggggggagga
A0A3Q3AEL8_BAD-02      ctcagggtgaactcggagtcgctctcctccaccagctccaggggggagga

A0A3Q3AEL8_BAD-01      ggagctcccggcgcgggcagacgacgagcccgggacccccaccgaggggt
A0A3Q3AEL8_BAD-02      ggagctcccggcgcgggcagacgacgagcccgggacccccaccgaggggt

A0A3Q3AEL8_BAD-01      atccgttcagggggcgatccaagtcggcccctccagccctgtgggccgcc
A0A3Q3AEL8_BAD-02      atccgttcagggggcgatccaagtcggcccctccagccctgtgggccgcc

A0A3Q3AEL8_BAD-01      aagaagtacggccggcagctccgccggatgagcgacgagttcgacagcct
A0A3Q3AEL8_BAD-02      aagaagtacggccggcagctccgccggatgagcgacgagttcgacagcct

A0A3Q3AEL8_BAD-01      gctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
A0A3Q3AEL8_BAD-02      gctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac

A0A3Q3AEL8_BAD-01      agatacaccactcccgaagctggtggaactacctctttagtcaccaggag
A0A3Q3AEL8_BAD-02      agatacaccactcccgaagctggtggaactacctctttagtcaccaggag

A0A3Q3AEL8_BAD-01      acggacggcgagagcagccaccacgagaagccgacccaccgcaccgagta
A0A3Q3AEL8_BAD-02      acggacggcgagagcagccaccacgagaagccgacccaccgcaccgagta

A0A3Q3AEL8_BAD-01      a
A0A3Q3AEL8_BAD-02      a

© 1998-2020Legal notice