Dataset for CDS classical BH3-containing proteins of organism Junco hyemalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5IIR3_BMF-01       atgg------atcgcccca----------gctacctg--gaagaggacta
A0A8C5IIR3_BMF-02       atgg------atcgcccca----------gctacctg--gaagaggacta
A0A8C5IZK3_BCL2L11      atggccaagcagccccccgaggtgaaggcgcgacgcgacggcgagggcgg
                        ****      * * ****           ** **  *  *  **** *  

A0A8C5IIR3_BMF-01       -----ttctagc-ctggatgggctggacgatgacgt---gtttcactctg
A0A8C5IIR3_BMF-02       -----ttctagc-ctggatgggctggacgatgacgt---gtttcactctg
A0A8C5IZK3_BCL2L11      gcggctgccggcggcggaggggccgggcccgggcgcgcagctgcgccccg
                             * *  **   *** **** ** *   * **    * * * * * *

A0A8C5IIR3_BMF-01       atgactttg--gacttgcaggtcagcctggtgagatgactgcaac---tg
A0A8C5IIR3_BMF-02       atgactttg--gacttgcaggtcagcctggtgagatgactgcaac---tg
A0A8C5IZK3_BCL2L11      gcgctcccgccgccctgcccg--gggccggcgcggtgtccgcggcgcggg
                          *     *  * * ***  *   * * ** * * ** * **  *    *

A0A8C5IIR3_BMF-01       gctttttcacacagaaccagtcctacagctgccttc--------------
A0A8C5IIR3_BMF-02       gctttttcacacagaaccagtcctacagctgccttc--------------
A0A8C5IZK3_BCL2L11      gcccgcccgc-cagccccggcccctttgccacccgctcgccgctcttcat
                        **     * * ***  ** * **    **  **  *              

A0A8C5IIR3_BMF-01       -----tggggaggtttcaactattccccctcacacactgc-tgtggtccc
A0A8C5IIR3_BMF-02       -----tggggaggtttcaactattccccctcacacactgc-tgtggtccc
A0A8C5IZK3_BCL2L11      cttcgtgcggaggtcgccgctgctgccgcgctcctccagcgggtacttct
                             ** ******  *  **  * ** * * *   * **  **  * * 

A0A8C5IIR3_BMF-01       ggtatcaggc----------------atcctgagcagcaggacaaggcaa
A0A8C5IIR3_BMF-02       ggtatcaggc----------------atcctgagcagcaggacaaggcaa
A0A8C5IZK3_BCL2L11      cgttcgaagccgagcgcagccccgcgcccctgagctgc--gacaaggcca
                         **   * **                  ******* **  ******** *

A0A8C5IIR3_BMF-01       ctcaaacactcagcccatcctcttccagtcaggatgttatgttgccttgt
A0A8C5IIR3_BMF-02       ctcaaacactcagcccatcctcttccagtcaggatgttatgttgccttgt
A0A8C5IZK3_BCL2L11      cgcagacccccagcccgccct------gccaag--------------cgc
                        * ** ** * ******  ***      * ** *               * 

A0A8C5IIR3_BMF-01       ggagtcactg---aagagccacggagactcttctatgggagtgctggtta
A0A8C5IIR3_BMF-02       ggagtcactg---aagagccacggagactcttctatgggagtgctggtta
A0A8C5IZK3_BCL2L11      tcagccactgcctcagcgccatgg--------------------------
                          ** *****    ** **** **                          

A0A8C5IIR3_BMF-01       ccgtttacatgtccctccagctggctttgtgttggatccgcagctccagg
A0A8C5IIR3_BMF-02       ccgtttacatgtccctccagctggctttgtgttggatccgcagctccagg
A0A8C5IZK3_BCL2L11      -------------catcccggtggc---------aatcccactctccagg
                                     * *** * ****          ****    *******

A0A8C5IIR3_BMF-01       aggaccctcaggaaggtcagcgggaagcacgtgctgaggtgcagatcgca
A0A8C5IIR3_BMF-02       aggaccctcaggaaggtcagcgggaagcacgtgctgaggtgcagatcgca
A0A8C5IZK3_BCL2L11      cg-------aggaggtgcagc------------cggagatctggatcgcg
                         *       **** *  ****            * *** *   ****** 

A0A8C5IIR3_BMF-01       cggaagttgcagtgcattgccgaccagttccaccggctccacatacagag
A0A8C5IIR3_BMF-02       cggaagttgcagtgcattgccgaccagttccaccggctccacatacagag
A0A8C5IZK3_BCL2L11      caggagctgcggcgcatcggcgacgagttcaat--gcctcttat------
                        * * ** *** * **** * **** ***** *   **  *  **      

A0A8C5IIR3_BMF-01       gcatcagcagaacagaaatcaagtgtggtggcagctttttctcttcctac
A0A8C5IIR3_BMF-02       gcatcagcagaacagaaatcaagtgtggtggcagctttttctcttcctac
A0A8C5IZK3_BCL2L11      -tgtc--------------cacgcagggtaac----tttcccctcttcac
                           **              ** *   ***  *    *** * **    **

A0A8C5IIR3_BMF-01       acaacttggccttaaacacggaggtgaacaggaaccacactgggcagagg
A0A8C5IIR3_BMF-02       acaacttggccttaaacacggaggtgaacaggaaccacactgggcagagg
A0A8C5IZK3_BCL2L11      ctcccgtgtctct-----cgaagggg-------------------agggc
                            * ** *  *     ** *** *                   ** * 

A0A8C5IIR3_BMF-01       tga
A0A8C5IIR3_BMF-02       tga
A0A8C5IZK3_BCL2L11      tga
                        ***

© 1998-2022Legal notice