Dataset for CDS classical BH3-containing proteins of organism Jaculus jaculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5KS76_BBC3-01      ---------------atgg------------------------cccgcgc
A0A8C5P449_BAD-01       ---------------atggggactccaaagaagccatcactgcctcccac
A0A8C5KS51_BIK-01       ---------------atgt--------------------------cagag
A0A8C5K765_BMF-01       ---------------atgg-----------------------------a-
A0A8C5K765_BMF-02       attttcccaggggagatgg-----------------------------a-
A0A8C5L6N3_BCL2L11      ---------------atgg--------------------------caaa-
A0A8C5L6N3_BCL2L11      ---------------atgg--------------------------caaa-
A0A8C5L6N3_BCL2L11      ---------------atgg--------------------------caaa-
                                       ***                                

A0A8C5KS76_BBC3-01      acgac-----------aggagggcagttc------tccggagccc-----
A0A8C5P449_BAD-01       agaacctcaaggcgtgaggaagtcggagcctggcatccggagcctcggga
A0A8C5KS51_BIK-01       gcaagacccatttctgggaatgtt--------------ttcactgagacc
A0A8C5K765_BMF-01       accacctcagtgtgtagaagagctggaagatgatgtattccaaccagagg
A0A8C5K765_BMF-02       accacctcagtgtgtagaagagctggaagatgatgtattccaaccagagg
A0A8C5L6N3_BCL2L11      gcaaccttcagatgta----agtt--------------------ctgagt
A0A8C5L6N3_BCL2L11      gcaaccttcagatgta----agtt--------------------ctgagt
A0A8C5L6N3_BCL2L11      gcaaccttcagatgta----agtt--------------------ctgagt
                           *                 *                            

A0A8C5KS76_BBC3-01      ---------gtagagggc-ttggcccgcgacggcccgcgccccttcccac
A0A8C5P449_BAD-01       gcgacgccggaggaaggcggtggcgactggcagcccagagcatgttcca-
A0A8C5KS51_BIK-01       ttcctgcaccagcaggc--------cctgggagctcccgtcatt------
A0A8C5K765_BMF-01       atgaggagccagggacgc-----agcctgggagcttgctct-ct------
A0A8C5K765_BMF-02       atgaggagccagggacgc-----agcctgggagcttgctct-ct------
A0A8C5L6N3_BCL2L11      gtga----ccgagaagg----------tggacaattgcagc-ct------
A0A8C5L6N3_BCL2L11      gtga----ccgagaagg----------tggacaattgcagc-ct------
A0A8C5L6N3_BCL2L11      gtga----ccgagaagg----------tggacaattgcagc-ct------
                                                    *                     

A0A8C5KS76_BBC3-01      tcggccgcctggtcccctcggctgtgtcctg---------------cggc
A0A8C5P449_BAD-01       ----------gatcccagagtttgagccaagtgagcaggaagaatccagt
A0A8C5KS51_BIK-01       --------------------actgag------------------------
A0A8C5K765_BMF-01       --------------------gctgacc-------------------tgtt
A0A8C5K765_BMF-02       --------------------gctgacc-------------------tgtt
A0A8C5L6N3_BCL2L11      --------------------gctgaga-------------------ggcc
A0A8C5L6N3_BCL2L11      --------------------gctgaga-------------------ggcc
A0A8C5L6N3_BCL2L11      --------------------gctgaga-------------------ggcc
                                              **                          

A0A8C5KS76_BBC3-01      ctctgcgagcccggcctgcccgccgcccccgc-cgtccccgccttgctgc
A0A8C5P449_BAD-01       ttctcagagaggggcctgggccccagccctacgggcccccgacaggctcc
A0A8C5KS51_BIK-01       -cccgtgggggaagaggacctccctcccgtgggtgacttggatc------
A0A8C5K765_BMF-01       tgcccagagccagatggactgtcctctc--agccggctccagctcttccc
A0A8C5K765_BMF-02       tgcccagagccagatggactgtcctctc--agccggctccagctcttccc
A0A8C5L6N3_BCL2L11      tccccag---cag------------ctc--ag--gcctggggcccctacc
A0A8C5L6N3_BCL2L11      tccccag---cag------------ctc--ag--gcctggggcccctacc
A0A8C5L6N3_BCL2L11      tccccag---cag------------ctc--ag--gcctggggcccctacc
                          *   *                    *      * *             

A0A8C5KS76_BBC3-01      ccgcagcct-----acctct------------------------------
A0A8C5P449_BAD-01       aggtctcttgggggacatca------------------------------
A0A8C5KS51_BIK-01       -----tcatggaatgcctcg------------------------------
A0A8C5K765_BMF-01       tc---tcacccattgctgtg------------------------------
A0A8C5K765_BMF-02       tc---tcacccattgctgtg------------------------------
A0A8C5L6N3_BCL2L11      tcccttcagacagtgccgca------------------------------
A0A8C5L6N3_BCL2L11      tcccttcagacagtgccgca------------------------------
A0A8C5L6N3_BCL2L11      tcccttcagacagtgccgcaaggtaatcctgaaggcgaaggggaccgctg
                              *        *                                  

A0A8C5KS76_BBC3-01      --------------------------------------------------
A0A8C5P449_BAD-01       --------------------------------------------------
A0A8C5KS51_BIK-01       --------------------------------------------------
A0A8C5K765_BMF-01       --------------------------------------------------
A0A8C5K765_BMF-02       --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      cccccacggcagccctcagggcccgctggccccaccggccagccctggcc
                                                                          

A0A8C5KS76_BBC3-01      --------------------------------------------------
A0A8C5P449_BAD-01       --------------------------------------------------
A0A8C5KS51_BIK-01       --------------------------------------------------
A0A8C5K765_BMF-01       --------------------------------------------------
A0A8C5K765_BMF-02       --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      cttttgctaccagatccccacttttcatctttgtgagaagatcttctctg
                                                                          

A0A8C5KS76_BBC3-01      -----------------------gcgccccgaccgccccgaccgccgtca
A0A8C5P449_BAD-01       -----------------------gt-taccggcag---cggccgcagcca
A0A8C5KS51_BIK-01       -------------------------------------agggcagtaacca
A0A8C5K765_BMF-01       ---------------------------------gtcctgggctccggccc
A0A8C5K765_BMF-02       ---------------------------------gtcctgggctccggccc
A0A8C5L6N3_BCL2L11      --------------------------------------agacaggagccc
A0A8C5L6N3_BCL2L11      --------------------------------------agacaggagccc
A0A8C5L6N3_BCL2L11      ctgtctcgatcttccagtgggtatttctcttttgacacagacaggagccc
                                                               * *      * 

A0A8C5KS76_BBC3-01      cc--------gccaccctggggggctcccgctggcctgggggtccccgca
A0A8C5P449_BAD-01       tcgaacagcagccactatggagg----cggcggggctttggagacccgga
A0A8C5KS51_BIK-01       ----------ggtggccctgcgg-------ttggcctgcattggagatga
A0A8C5K765_BMF-01       ----------accagccaggaa-----------gac-------aaggcca
A0A8C5K765_BMF-02       ----------accagccaggaa-----------gac-------aaggcca
A0A8C5L6N3_BCL2L11      ----------ggcacccatgagt-------tgtgac-------aaatcaa
A0A8C5L6N3_BCL2L11      ----------ggcacccatgagt-------tgtgac-------aaatcaa
A0A8C5L6N3_BCL2L11      ----------ggcacccatgagt-------tgtgac-------aaatcaa
                                           *             * *             *

A0A8C5KS76_BBC3-01      gccggccccgaggccc---gcgccctgacggtcccgatctctcgctgtcc
A0A8C5P449_BAD-01       gtcg---ccacagttc---gtaccctgcgggaaccgaagaggatggaggc
A0A8C5KS51_BIK-01       gatggacctccgtctccggagcccccgtttggtccag---------ttgc
A0A8C5K765_BMF-01       ctcagaccctcagccc-----agcctccccaagccagggtgtcatgctgc
A0A8C5K765_BMF-02       ctcagaccctcagccc-----agcctccccaagccagggtgtcatgctgc
A0A8C5L6N3_BCL2L11      cacaaaccccaagtcc-----tccct------gccag-----------gc
A0A8C5L6N3_BCL2L11      cacaaaccccaagtcc-----tccct------gccag-----------gc
A0A8C5L6N3_BCL2L11      cacaaaccccaagtcc-----tccct------gccag-----------gc
                               *       *       **        **              *

A0A8C5KS76_BBC3-01      ccggccgagcagca-------------c--------ctcgagtcgcccgt
A0A8C5P449_BAD-01       atggaggaggagct-------------cagtcccttccgaggccgctcgc
A0A8C5KS51_BIK-01       ct---gggatggccatgcacagcctggctgtcacctacggccagacaggt
A0A8C5K765_BMF-01       cttgtggggtgactgaggaaccccagcgacttttttacggcaatgctggc
A0A8C5K765_BMF-02       cttgtggggtgactgaggaaccccagcgacttttttacggcaatgctggc
A0A8C5L6N3_BCL2L11      ctt--------------------caaccattatctcagtgcaatg-----
A0A8C5L6N3_BCL2L11      ctt--------------------caaccattatctcagtgcaatg-----
A0A8C5L6N3_BCL2L11      ctt--------------------caaccattatctcagtgcaatg-----
                                                                          

A0A8C5KS76_BBC3-01      gcccagcgccccggaggccctggagggcggtcccacccag----gcggcc
A0A8C5P449_BAD-01       gctcggctccccccaacctctggg--------ctgcccagcgctacggcc
A0A8C5KS51_BIK-01       gtcag---------------tggt--------gttcttagaagcttggtc
A0A8C5K765_BMF-01       taccggcttcctctccctgccagt--------ttccccacaggcttgccc
A0A8C5K765_BMF-02       taccggcttcctctccctgccagt--------ttccccacaggcttgccc
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      --------------------------------gcttccataaggcagtct
A0A8C5L6N3_BCL2L11      --------------------------------gcttccataaggcagtct
                                                                          

A0A8C5KS76_BBC3-01      ccgggagtg------cgcggggaggaggagcagtgggcccgggagatc--
A0A8C5P449_BAD-01       gcgagc-----------tgcggaggatgagcgacgagtttgagggttcct
A0A8C5KS51_BIK-01       catgg----------cctcattgacctcagcaagaacctaaggtgct---
A0A8C5K765_BMF-01       cttgaggagcagccccctgaagggcagtggccacatcgagccgaggt---
A0A8C5K765_BMF-02       cttgaggagcagccccctgaagggcagtggccacatcgagccgaggt---
A0A8C5L6N3_BCL2L11      -------------------------cacatcca---------ga------
A0A8C5L6N3_BCL2L11      caggaggaa------cctacagatatgcgtcca---------gaaat---
A0A8C5L6N3_BCL2L11      caggaggaa------cctacagatatgcgtcca---------gaaat---
                                                      *           *       

A0A8C5KS76_BBC3-01      ----ggggcccagctgcggcggatggcggacgacctgaacgcgcagtacg
A0A8C5P449_BAD-01       tcaaggggcttcctcgc----------------ccaaagagcgcag---g
A0A8C5KS51_BIK-01       ----ggagtctccccac----------------ccctagcgcttgg---g
A0A8C5K765_BMF-01       ----acagatcgcccg---------------------aaagcttca---g
A0A8C5K765_BMF-02       ----acagatcgcccg---------------------aaagcttca---g
A0A8C5L6N3_BCL2L11      ------gcaatccaca---------------------ggatcag------
A0A8C5L6N3_BCL2L11      ----atggattgcaca---------------------ggagctgcg---g
A0A8C5L6N3_BCL2L11      ----atggattgcaca---------------------ggagctgcg---g
                                                                 *        

A0A8C5KS76_BBC3-01      agcggcggaggcaag-----------------------------------
A0A8C5P449_BAD-01       cacggcg-------------------------------------------
A0A8C5KS51_BIK-01       tgcaccgtggccaggtct--------------------------------
A0A8C5K765_BMF-01       tgcattgcagaccagttccac---------------cggcttcatttgca
A0A8C5K765_BMF-02       tgcattgcagaccagttccac---------------cggcttcatttgca
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      cgcatcggagatgagttcaatgcttactacccaaggagggtattcttgaa
A0A8C5L6N3_BCL2L11      cgcatcggagatgagttcaatgcttactacccaaggagggtattcttgaa
                                                                          

A0A8C5KS76_BBC3-01      --aagagcagcagcgacatcgcccctcgccctggagggtcgtgtacaatc
A0A8C5P449_BAD-01       ----acacagatgcggcaaagctcc-------agttggacccgcatcatc
A0A8C5KS51_BIK-01       ----------gcaggcagctgccgcccct-gctgctggccctcc------
A0A8C5K765_BMF-01       gcaacaccagcagaaccgtgaccgcgcgtggtggcaagtcttcc------
A0A8C5K765_BMF-02       gcaacaccagcagaaccgtgaccgcgcgtggtggcaagtcttcc------
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      taattaccaagcagctgaggaccaccctcaaatggttatcttaa------
A0A8C5L6N3_BCL2L11      taattaccaagcagctgaggaccaccctcaaatggttatcttaa------
                                                                          

A0A8C5KS76_BBC3-01      ---tcttcatggggctcctcccctta-cccaggggccctggagccccaga
A0A8C5P449_BAD-01       cagtcctggtggga-------tcgaa-atctggggagaggaggcccc---
A0A8C5KS51_BIK-01       ---tgctgctgggtgg---agccctgcacctgctg---------------
A0A8C5K765_BMF-01       ---ttttcctgcacaacctggccttgaaccgggaagaaaacagagatggg
A0A8C5K765_BMF-02       ---ttttcctgcacaacctggccttgaaccgggaagaaaacagagatggg
A0A8C5L6N3_BCL2L11      --------------------------------------------------
A0A8C5L6N3_BCL2L11      ---gactgttgcgttacttcgtcc---gcctggtgtggagaagacat---
A0A8C5L6N3_BCL2L11      ---gactgttgcgttacttcgtcc---gcctggtgtggagaagacat---
                                                                          

A0A8C5KS76_BBC3-01      gatggagcccaattaa
A0A8C5P449_BAD-01       gctccatcccagtga-
A0A8C5KS51_BIK-01       ------cttcagtga-
A0A8C5K765_BMF-01       gcgggtcccaggtga-
A0A8C5K765_BMF-02       gcgggtcccaggtga-
A0A8C5L6N3_BCL2L11      ----------------
A0A8C5L6N3_BCL2L11      ------------tga-
A0A8C5L6N3_BCL2L11      ------------tga-
                                        

© 1998-2022Legal notice