Dataset for CDS BMF of organism Jaculus jaculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5K765_BMF-01      ---------------atggaaccacctcagtgtgtagaagagctggaaga
A0A8C5K765_BMF-02      attttcccaggggagatggaaccacctcagtgtgtagaagagctggaaga
                                      ***********************************

A0A8C5K765_BMF-01      tgatgtattccaaccagaggatgaggagccagggacgcagcctgggagct
A0A8C5K765_BMF-02      tgatgtattccaaccagaggatgaggagccagggacgcagcctgggagct
                       **************************************************

A0A8C5K765_BMF-01      tgctctctgctgacctgtttgcccagagccagatggactgtcctctcagc
A0A8C5K765_BMF-02      tgctctctgctgacctgtttgcccagagccagatggactgtcctctcagc
                       **************************************************

A0A8C5K765_BMF-01      cggctccagctcttccctctcacccattgctgtggtcctgggctccggcc
A0A8C5K765_BMF-02      cggctccagctcttccctctcacccattgctgtggtcctgggctccggcc
                       **************************************************

A0A8C5K765_BMF-01      caccagccaggaagacaaggccactcagaccctcagcccagcctccccaa
A0A8C5K765_BMF-02      caccagccaggaagacaaggccactcagaccctcagcccagcctccccaa
                       **************************************************

A0A8C5K765_BMF-01      gccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactt
A0A8C5K765_BMF-02      gccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactt
                       **************************************************

A0A8C5K765_BMF-01      ttttacggcaatgctggctaccggcttcctctccctgccagtttccccac
A0A8C5K765_BMF-02      ttttacggcaatgctggctaccggcttcctctccctgccagtttccccac
                       **************************************************

A0A8C5K765_BMF-01      aggcttgccccttgaggagcagccccctgaagggcagtggccacatcgag
A0A8C5K765_BMF-02      aggcttgccccttgaggagcagccccctgaagggcagtggccacatcgag
                       **************************************************

A0A8C5K765_BMF-01      ccgaggtacagatcgcccgaaagcttcagtgcattgcagaccagttccac
A0A8C5K765_BMF-02      ccgaggtacagatcgcccgaaagcttcagtgcattgcagaccagttccac
                       **************************************************

A0A8C5K765_BMF-01      cggcttcatttgcagcaacaccagcagaaccgtgaccgcgcgtggtggca
A0A8C5K765_BMF-02      cggcttcatttgcagcaacaccagcagaaccgtgaccgcgcgtggtggca
                       **************************************************

A0A8C5K765_BMF-01      agtcttccttttcctgcacaacctggccttgaaccgggaagaaaacagag
A0A8C5K765_BMF-02      agtcttccttttcctgcacaacctggccttgaaccgggaagaaaacagag
                       **************************************************

A0A8C5K765_BMF-01      atggggcgggtcccaggtga
A0A8C5K765_BMF-02      atggggcgggtcccaggtga
                       ********************

© 1998-2022Legal notice