Dataset for CDS classical BH3-containing proteins of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287DFJ0_BCL2L11      atg-----------------------------------------------
A0A287DFJ0_BCL2L11      atg-----------------------------------------------
A0A287CT05_BAD-02       atg-----------gggatcccagaaaaagccctcatcgcttccacgcac
A0A287CT05_BAD-01       atg-----------gggatcccagaaaaagccctcatcgcttccacgcac
I3LVX0_BIK-01           atg--------------gttcagg--------------------------
A0A287CXH0_BMF-01       atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtgg
A0A287CXH0_BMF-02       -----------------gtttt----------------------------
                                                                          

A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287CT05_BAD-02       gct-----------------------------------------------
A0A287CT05_BAD-01       gct-----------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A287CXH0_BMF-01       cctcctccggcgcccgccagagtccgcagccgccgccggccctgccagcg
A0A287CXH0_BMF-02       --------------------------------------------------
                                                                          

A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A287CXH0_BMF-01       gctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacg
A0A287CXH0_BMF-02       --------------------------------------------------
                                                                          

A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287CT05_BAD-02       --------------------------------------------------
A0A287CT05_BAD-01       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
A0A287CXH0_BMF-01       ctggaccctggcgcagagccctggcatcacgactcggaggccgagactct
A0A287CXH0_BMF-02       --------------------------------------------------
                                                                          

A0A287DFJ0_BCL2L11      -----------gcaaagcaaccttccgatgtaagttctgagtgtgacaga
A0A287DFJ0_BCL2L11      -----------gcaaagcaaccttccgatgtaagttctgagtgtgacaga
A0A287CT05_BAD-02       -----ccaggcgcgaggaagtc-----agggaa--------------gga
A0A287CT05_BAD-01       -----ccaggcgcgaggaagtc-----agggaa--------------gga
I3LVX0_BIK-01           -----gcagtcaccaggtggcc-----ctgcgactggcctgcattgggga
A0A287CXH0_BMF-01       ctcctggagtcacccaggtgag-----atggagccgcctcagtgtgtgga
A0A287CXH0_BMF-02       ------------cccagaggag-----atggagccgcctcagtgtgtgga
                                    *   *            *                  **

A0A287DFJ0_BCL2L11      gaaggtggacaa-------ttgcagcctgcag----------agaggcct
A0A287DFJ0_BCL2L11      gaaggtggacaa-------ttgcagcctgcag----------agaggcct
A0A287CT05_BAD-02       gggaccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggc
A0A287CT05_BAD-01       gggaccggggaggaaggcggtaggacccgcaggtcggcggcgagggtggc
I3LVX0_BIK-01           tgagatgga----tctgtgttt------------------tcagga----
A0A287CXH0_BMF-01       ggagctggaagatgatgtgttccagccagaggatggggagccaggg----
A0A287CXH0_BMF-02       ggagctggaagatgatgtgttccagccagaggatggggagccaggg----
                              **            *                     **      

A0A287DFJ0_BCL2L11      ccccagctcaggccgggggcc----cctacctcccttcagacagagcctc
A0A287DFJ0_BCL2L11      ccccagctcaggccgggggcc----cctacctcccttcagacagagcctc
A0A287CT05_BAD-02       acccggcctggacccagagcatgttc-cagatcccag-agtttgagccca
A0A287CT05_BAD-01       acccggcctggacccagagcatgttc-cagatcccag-agtttgagccca
I3LVX0_BIK-01           cctccaactgg--------------cccagctgcctg-ggat---ggcca
A0A287CXH0_BMF-01       acccagcctgg-----gagcttgctctctgctgactt-gttt---gccca
A0A287CXH0_BMF-02       acccagcctgg-----gagcttgctctctgctgactt-gttt---gccca
                         * *      *              *     *  *          * *  

A0A287DFJ0_BCL2L11      --------a-----------------------------------------
A0A287DFJ0_BCL2L11      --------aaggtaatcccgaaggcgaaggggaccgctgcccccacggca
A0A287CT05_BAD-02       g-------tgagcag--------gaagactccagct------------cc
A0A287CT05_BAD-01       g-------tgagcag--------gaagactccagct------------cc
I3LVX0_BIK-01           --------tgcacagcc---------------------ttgctctcagct
A0A287CXH0_BMF-01       gagccagctggactgccccctcagcaggcttcagctcttccctctcaccc
A0A287CXH0_BMF-02       gagccagctggactgccccctcagcaggcttcagctcttccctctcaccc
                                                                          

A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      gcccacagggcccgctggccccaccggccagccctggcccttttgctacc
A0A287CT05_BAD-02       gcagaagggggcctgggccccagc---cccgcaggggacc---ggccag-
A0A287CT05_BAD-01       gcagaagggggcctgggccccagc---cccgcaggggacc---ggccag-
I3LVX0_BIK-01           acagc----------------------caggcgagagtcacgggtgtgc-
A0A287CXH0_BMF-01       actgctgtggtcctgggcttcgacctaccagccaggaagacaaggccac-
A0A287CXH0_BMF-02       actgctgtggtcctgggcttcgacctaccagccaggaagacaaggccac-
                                                                          

A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      agatccccgcttttcatctttgtgagaagatcttccct--gctgtctcga
A0A287CT05_BAD-02       ----------------------gctgcggcttggctccaggcctccccag
A0A287CT05_BAD-01       ----------------------gctgcggcttggctccaggcctccccag
I3LVX0_BIK-01           ----------------------tcagaagcttggcccagggtctcgccag
A0A287CXH0_BMF-01       ----------------------tcagaccctcagccca--gcctccccaa
A0A287CXH0_BMF-02       ----------------------tcagaccctcagccca--gcctccccaa
                                                                          

A0A287DFJ0_BCL2L11      -----------------------------agacaggagcccagcacccat
A0A287DFJ0_BCL2L11      tcctccagtgggtatttctcttttgacacagacaggagcccagcacccat
A0A287CT05_BAD-02       ggacacgg----------gtcaccagcagtggcaggcaaccagca-----
A0A287CT05_BAD-01       ggacacgg----------gtcaccagcagtggcaggcaaccagca-----
I3LVX0_BIK-01           cctcagggagaacatgtggtt-----------ctggagacctgca-----
A0A287CXH0_BMF-01       gc-cagggtg-tcatgctgccttgtggagtgactgaagaacccca-----
A0A287CXH0_BMF-02       gc-cagggtg-tcatgctgccttgtggagtgactgaagaacccca-----
                                                        * *     *  **     

A0A287DFJ0_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A287DFJ0_BCL2L11      gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttca
A0A287CT05_BAD-02       -----gcagcaaccatggaggcgctggggctacggagacccggagtcgcc
A0A287CT05_BAD-01       -----gcagcaaccatggaggcgctggggctacggagacccggagtcgcc
I3LVX0_BIK-01           -----gc----------------ccccagcacccgggtgcc---------
A0A287CXH0_BMF-01       -----gcgactcttttatggcaatgctggctaccggcttcc---------
A0A287CXH0_BMF-02       -----gcgactcttttatggcaatgctggctaccggcttcc---------
                             *                          *      **         

A0A287DFJ0_BCL2L11      acca----ttatctgagtgcaatggcttccatgcgggagtctcaggcaga
A0A287DFJ0_BCL2L11      acca----ttatctgagtgcaatggcttccatgcgggagtctcaggcaga
A0A287CT05_BAD-02       acagctcgtaccccgcagataccgatttggatgaagggatggaagaggag
A0A287CT05_BAD-01       acagctcgtaccccgcagataccgatttggatgaagggatggaagaggag
I3LVX0_BIK-01           --------t---cc-----tgcc----------cggg-------------
A0A287CXH0_BMF-01       --------tctccc-----tgctagtttccctgcagg-------------
A0A287CXH0_BMF-02       --------tctccc-----tgctagtttccctgcagg-------------
                                *   *                      **             

A0A287DFJ0_BCL2L11      acctgc-------agacatgcgccc-------------------------
A0A287DFJ0_BCL2L11      acctgc-------agacatgcgccc-------------------------
A0A287CT05_BAD-02       cccagccccttccgcggccgctcgcgctcggcgccccccaatctctgggc
A0A287CT05_BAD-01       cccagccccttccgcggccgctcgcgctcggcgccccccaatctctgggc
I3LVX0_BIK-01           -cctgcc-----gggagctgctgcc------cg-----------------
A0A287CXH0_BMF-01       -cttgccccttggagagcagccccc------tgaaggtcagtggcaacat
A0A287CXH0_BMF-02       -cttgccccttggagagcagccccc------tgaaggtcagtggcaacat
                         *  **             **   *                         

A0A287DFJ0_BCL2L11      -----ggagatctggatcgcgcaggagctgcggcgaatcggagatgagtt
A0A287DFJ0_BCL2L11      -----ggagatctggatcgcgcaggagctgcggcgaatcggagatgagtt
A0A287CT05_BAD-02       tgcacagcgctacgg-----ccgcgagctccggaggatgagcgacgaatt
A0A287CT05_BAD-01       tgcacagcgctacgg-----ccgcgagctccggaggatgagcgacgaatt
I3LVX0_BIK-01           --------------------------------------------------
A0A287CXH0_BMF-01       cgagcagaggtacagatcgcccgaaaacttcagtgcattgcagaccagtt
A0A287CXH0_BMF-02       cgagcagaggtacagatcgcccgaaaacttcagtgcattgcagaccagtt
                                                                          

A0A287DFJ0_BCL2L11      taacctgtattacccacggagggtattttttaataattaccaacctgaag
A0A287DFJ0_BCL2L11      taacctgtattacccacggagggtattttttaataattaccaacctgaag
A0A287CT05_BAD-02       cgagggctcctttaaggtgacattttc-----------------------
A0A287CT05_BAD-01       cgagggctcctttaagg-gacttcctcgcccgaggagcgcaggcacagcg
I3LVX0_BIK-01           --------------------------------------------------
A0A287CXH0_BMF-01       ccaccggcttcatatgc-agcaacaccagcagaaccgaaatcgtgtgtgg
A0A287CXH0_BMF-02       ccaccggcttcatatgc-agcaacaccagcagaaccgaaatcgtgtgtgg
                                                                          

A0A287DFJ0_BCL2L11      accgcccccaaatggttatcttgcgcctgttgcgttgcatcatccgcctg
A0A287DFJ0_BCL2L11      accgcccccaaatggttatcttgcgcctgttgcgttgcatcatccgcctg
A0A287CT05_BAD-02       -------------------ccagtc---------------------ccca
A0A287CT05_BAD-01       tcgcagatgcggcaaagctccagctggacgcgc---------ttcatcca
I3LVX0_BIK-01           ---------------------tgctgctgctgc---------tgggcctg
A0A287CXH0_BMF-01       tggcagat-----------tctcctcttcctgc---------acaacctg
A0A287CXH0_BMF-02       tggcagat-----------tctcctcttcctgc---------acaacctg
                                                                       *  

A0A287DFJ0_BCL2L11      gtgtggagga----------------------------------tgcact
A0A287DFJ0_BCL2L11      gtgtggagga----------------------------------tgcact
A0A287CT05_BAD-02       ttcctgaggg----------------------------------cctaa-
A0A287CT05_BAD-01       gtcctggtgggatcggaacttggggaggcgaggctccgccccctcccagt
I3LVX0_BIK-01           ttgct------------gagcagggccctgtacctgcggctc--c--agt
A0A287CXH0_BMF-01       gcattaaatggagatgagaacagggaccgg-----gcaggtc--ctaggt
A0A287CXH0_BMF-02       gcattaaatggagatgagaacagggaccgg-----gcaggtc--ctaggt
                                                                          

A0A287DFJ0_BCL2L11      ga
A0A287DFJ0_BCL2L11      ga
A0A287CT05_BAD-02       --
A0A287CT05_BAD-01       ga
I3LVX0_BIK-01           ga
A0A287CXH0_BMF-01       ga
A0A287CXH0_BMF-02       ga
                          

© 1998-2020Legal notice