Dataset for CDS BMF of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287CXH0_BMF-01      atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtgg
A0A287CXH0_BMF-02      -----------------gtttt----------------------------
                                         ****                            

A0A287CXH0_BMF-01      cctcctccggcgcccgccagagtccgcagccgccgccggccctgccagcg
A0A287CXH0_BMF-02      --------------------------------------------------
                                                                         

A0A287CXH0_BMF-01      gctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacg
A0A287CXH0_BMF-02      --------------------------------------------------
                                                                         

A0A287CXH0_BMF-01      ctggaccctggcgcagagccctggcatcacgactcggaggccgagactct
A0A287CXH0_BMF-02      --------------------------------------------------
                                                                         

A0A287CXH0_BMF-01      ctcctggagtcacccaggtgagatggagccgcctcagtgtgtggaggagc
A0A287CXH0_BMF-02      ------------cccagaggagatggagccgcctcagtgtgtggaggagc
                                   *****  *******************************

A0A287CXH0_BMF-01      tggaagatgatgtgttccagccagaggatggggagccagggacccagcct
A0A287CXH0_BMF-02      tggaagatgatgtgttccagccagaggatggggagccagggacccagcct
                       **************************************************

A0A287CXH0_BMF-01      gggagcttgctctctgctgacttgtttgcccagagccagctggactgccc
A0A287CXH0_BMF-02      gggagcttgctctctgctgacttgtttgcccagagccagctggactgccc
                       **************************************************

A0A287CXH0_BMF-01      cctcagcaggcttcagctcttccctctcacccactgctgtggtcctgggc
A0A287CXH0_BMF-02      cctcagcaggcttcagctcttccctctcacccactgctgtggtcctgggc
                       **************************************************

A0A287CXH0_BMF-01      ttcgacctaccagccaggaagacaaggccactcagaccctcagcccagcc
A0A287CXH0_BMF-02      ttcgacctaccagccaggaagacaaggccactcagaccctcagcccagcc
                       **************************************************

A0A287CXH0_BMF-01      tccccaagccagggtgtcatgctgccttgtggagtgactgaagaacccca
A0A287CXH0_BMF-02      tccccaagccagggtgtcatgctgccttgtggagtgactgaagaacccca
                       **************************************************

A0A287CXH0_BMF-01      gcgactcttttatggcaatgctggctaccggcttcctctccctgctagtt
A0A287CXH0_BMF-02      gcgactcttttatggcaatgctggctaccggcttcctctccctgctagtt
                       **************************************************

A0A287CXH0_BMF-01      tccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaa
A0A287CXH0_BMF-02      tccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaa
                       **************************************************

A0A287CXH0_BMF-01      catcgagcagaggtacagatcgcccgaaaacttcagtgcattgcagacca
A0A287CXH0_BMF-02      catcgagcagaggtacagatcgcccgaaaacttcagtgcattgcagacca
                       **************************************************

A0A287CXH0_BMF-01      gttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgtgtgt
A0A287CXH0_BMF-02      gttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgtgtgt
                       **************************************************

A0A287CXH0_BMF-01      ggtggcagattctcctcttcctgcacaacctggcattaaatggagatgag
A0A287CXH0_BMF-02      ggtggcagattctcctcttcctgcacaacctggcattaaatggagatgag
                       **************************************************

A0A287CXH0_BMF-01      aacagggaccgggcaggtcctaggtga
A0A287CXH0_BMF-02      aacagggaccgggcaggtcctaggtga
                       ***************************

© 1998-2020Legal notice