Dataset for CDS PMAIP1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q13794_PMAIP1-02      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
Q13794_PMAIP1-01      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
                      **************************************************

Q13794_PMAIP1-02      tccagcaggaccggcgggtacggcgggtacggcgagggaccaagccggat
Q13794_PMAIP1-01      tccagcag------------------------------------------
                      ********                                          

Q13794_PMAIP1-02      ttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcc
Q13794_PMAIP1-01      --------------------------------------------------
                                                                        

Q13794_PMAIP1-02      tcctctctttcctcctcgccacttgcccttccccggggccacgaggaaca
Q13794_PMAIP1-01      --------------------------------------------------
                                                                        

Q13794_PMAIP1-02      agtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttgga
Q13794_PMAIP1-01      ---------agctggaagtcgagtgtgctactcaactcaggagatttgga
                               *****************************************

Q13794_PMAIP1-02      gacaaactgaacttccggcagaaacttctgaatctgatatccaaactctt
Q13794_PMAIP1-01      gacaaactgaacttccggcagaaacttctgaatctgatatccaaactctt
                      **************************************************

Q13794_PMAIP1-02      ctgctcaggaacctgactgcatcaaaaacttgcatgaggggactccttca
Q13794_PMAIP1-01      ctgctcaggaacctga----------------------------------
                      ****************                                  

Q13794_PMAIP1-02      aaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgc
Q13794_PMAIP1-01      --------------------------------------------------
                                                                        

Q13794_PMAIP1-02      attgtaattga
Q13794_PMAIP1-01      -----------
                                 

© 1998-2020Legal notice