Dataset for CDS PMAIP1 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q13794_PMAIP1-01      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc
Q13794_PMAIP1-02      atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggc

Q13794_PMAIP1-01      tccagcag------------------------------------------
Q13794_PMAIP1-02      tccagcaggaccggcgggtacggcgggtacggcgagggaccaagccggat

Q13794_PMAIP1-01      --------------------------------------------------
Q13794_PMAIP1-02      ttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcc

Q13794_PMAIP1-01      --------------------------------------------------
Q13794_PMAIP1-02      tcctctctttcctcctcgccacttgcccttccccggggccacgaggaaca

Q13794_PMAIP1-01      ---------agctggaagtcgagtgtgctactcaactcaggagatttgga
Q13794_PMAIP1-02      agtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttgga

Q13794_PMAIP1-01      gacaaactgaacttccggcagaaacttctgaatctgatatccaaactctt
Q13794_PMAIP1-02      gacaaactgaacttccggcagaaacttctgaatctgatatccaaactctt

Q13794_PMAIP1-01      ctgctcaggaacctga----------------------------------
Q13794_PMAIP1-02      ctgctcaggaacctgactgcatcaaaaacttgcatgaggggactccttca

Q13794_PMAIP1-01      --------------------------------------------------
Q13794_PMAIP1-02      aaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgc

Q13794_PMAIP1-01      -----------
Q13794_PMAIP1-02      attgtaattga

© 1998-2021Legal notice