Dataset for CDS BCL2L11 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O43521_BCL2L11-20      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
Q6JTU4_BCL2L11-01      atg-----------------------------------------aggcag
                       ***                                         *** **

O43521_BCL2L11-20      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
Q6JTU4_BCL2L11-01      gctg----aacctgcagatatgc-------gcccagagatatgg------
                        *      * ***** ** * **       ** ****  *  **      

O43521_BCL2L11-20      cctccctacagacagagccacaagtctcactctgtcaccca--ggctgga
Q6JTU4_BCL2L11-01      ---------------------------------atcgcccaagagttgcg
                                                         ** ****   * **  

O43521_BCL2L11-20      gtgcactggtg-cgatcttg--gctcac--tgcaacctccaactcccaag
Q6JTU4_BCL2L11-01      gcgtatcggagacgagtttaacgcttactatgcaa----------ggagg
                       * * *  ** * ***  **   *** **  *****            * *

O43521_BCL2L11-20      ttcaagcggttctcctgcctcagcctcccaagtag
Q6JTU4_BCL2L11-01      ttagag-----------------------aaatag
                       **  **                       ** ***

© 1998-2020Legal notice