Dataset for CDS BCL2L11 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O43521_BCL2L11-16      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-02      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-15      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-03      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-23      ------aagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-07      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-22      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-17      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-09      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-14      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-04      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-21      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-19      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-18      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-12      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-10      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-08      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-06      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-01      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-05      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
O43521_BCL2L11-13      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                                                                         

O43521_BCL2L11-16      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-02      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-15      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-03      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-23      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-07      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-22      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-17      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-09      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-14      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-04      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-21      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-19      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-18      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-12      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-10      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-08      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-06      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-01      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-05      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
O43521_BCL2L11-13      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                                                                         

O43521_BCL2L11-16      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-02      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-15      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-03      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-23      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-07      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-22      cctccctacagacagagccacaag--------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-17      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-09      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-14      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-04      cctccctacagacagagccacaag--------------------------
O43521_BCL2L11-21      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-19      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-18      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-12      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-11      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-10      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-08      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-06      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-01      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-05      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
O43521_BCL2L11-13      cctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggt
                                                                         

O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-19      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-18      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-12      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-10      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-08      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-06      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-01      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-05      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
O43521_BCL2L11-13      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                         

O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-19      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-18      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-12      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-11      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-10      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-08      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-06      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-01      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-05      tgccagccctggcccttttgctaccagatccccgcttttcatctttatga
O43521_BCL2L11-13      tgccagccctggccc-----------------------------------
                                                                         

O43521_BCL2L11-16      ------------------------------------tctcactctgtcac
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      --------------------------------------------------
O43521_BCL2L11-14      --------------------------------------------------
O43521_BCL2L11-04      --------------------------------------------------
O43521_BCL2L11-21      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-19      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-18      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-12      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-10      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-08      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-06      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-01      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-05      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      ccaggctggagt---gcactggtgcgatct--tggctcactgcaacctcc
O43521_BCL2L11-02      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-15      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-03      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-23      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-07      --------------------------------------------------
O43521_BCL2L11-22      --------------------------------------------------
Q6JTU4_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-09      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-14      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-04      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-21      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-19      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-18      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-12      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-10      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-08      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-06      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-01      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-05      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      aactcccaagttcaagcggttc----------------------------
O43521_BCL2L11-02      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
O43521_BCL2L11-15      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
O43521_BCL2L11-03      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
O43521_BCL2L11-23      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
O43521_BCL2L11-07      --------------------------------------------cttcca
O43521_BCL2L11-22      --------------------------------------------cttcca
Q6JTU4_BCL2L11-01      -------------------------------------------------a
O43521_BCL2L11-20      --------------------------------------------cttcca
O43521_BCL2L11-17      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtt----
O43521_BCL2L11-09      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-14      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-04      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-21      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
O43521_BCL2L11-19      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-18      aagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
O43521_BCL2L11-12      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
O43521_BCL2L11-11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-10      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-08      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
O43521_BCL2L11-06      aagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
O43521_BCL2L11-01      aagtcctccttgccagg---------------------------------
O43521_BCL2L11-05      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      -----------------------------------------------tcc
O43521_BCL2L11-02      tcctagaggatataggtgatctttcactgtgc-tttggatttatatttac
O43521_BCL2L11-15      tcctagaggatataggtgatctttcactgtgc-tttggatttatatttac
O43521_BCL2L11-03      -------ggatg-----actccgc-------------------tggatcc
O43521_BCL2L11-23      -------ggatg-----actccgc-------------------tggatcc
O43521_BCL2L11-07      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-22      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
Q6JTU4_BCL2L11-01      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-20      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-17      ------------------------------------agagaaataga---
O43521_BCL2L11-09      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-14      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-04      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-21      gggactag------------------------------------------
O43521_BCL2L11-19      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-18      aaatagaggaag-----ttgtcgtgtag----------------------
O43521_BCL2L11-12      ttgaataa------------------------------------------
O43521_BCL2L11-11      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-10      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-08      gggactag------------------------------------------
O43521_BCL2L11-06      aaatagaggaag-----ttgtcgtgtag----------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      tgaggcaggctg-----aacctgcagatatgcgcccagagatatggatc-
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      tgcctcag--------------------------------------cctc
O43521_BCL2L11-02      tggcttagatttgtatggccaccaccatagtcaagatacagaacaactca
O43521_BCL2L11-15      tggcttagatttgtatggccaccaccatagtcaagatacagaacaactca
O43521_BCL2L11-03      tccctcagaattgccctt----cat---agggaagttcagtggccact--
O43521_BCL2L11-23      tccctcagaattgccctt----cat---agggaagttcagtggccact--
O43521_BCL2L11-07      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-22      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
Q6JTU4_BCL2L11-01      -gcccaagagttgcggcg----tatcggagacgagtttaacgcttactat
O43521_BCL2L11-20      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-17      -----ggaagttgtcgtg----tag-------------------------
O43521_BCL2L11-09      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-14      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-04      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-10      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      -gcccaagagttgcggcg----tattggagacgagtttaacgcttactat
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      ccaagtag------------------------------------------
O43521_BCL2L11-02      accacaaggatttctcatga------------------------------
O43521_BCL2L11-15      accacaaggatttctcatga------------------------------
O43521_BCL2L11-03      -caagtggttagcaaaatcaagctaa------------------------
O43521_BCL2L11-23      -caagtggttagcaaaatcaagctaa------------------------
O43521_BCL2L11-07      gcaaggaggctg-------------gcaaaactcctggcatcctccacct
O43521_BCL2L11-22      gcaaggaggctg-------------gcaaaactcctggcatcctccacct
Q6JTU4_BCL2L11-01      gcaaggaggtta--------------------------------------
O43521_BCL2L11-20      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      gcaaggaggtta--------------------------------------
O43521_BCL2L11-14      gcaaggaggtta--------------------------------------
O43521_BCL2L11-04      gcaaggagggtatttttgaataattaccaagcagccgaagaccacccacg
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      gcaaggaggatgcctcttccacctgattaa--------------------
O43521_BCL2L11-10      gcaaggaggttagagaaatag-----------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      gcaaggagggtatttttgaataattaccaagcagccgaagaccacccacg
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      --------------------------------------------------
O43521_BCL2L11-02      --------------------------------------------------
O43521_BCL2L11-15      --------------------------------------------------
O43521_BCL2L11-03      --------------------------------------------------
O43521_BCL2L11-23      --------------------------------------------------
O43521_BCL2L11-07      ga------------------------------------------------
O43521_BCL2L11-22      ga------------------------------------------------
Q6JTU4_BCL2L11-01      -------------------------------------------------g
O43521_BCL2L11-20      --------------------------------------------------
O43521_BCL2L11-17      --------------------------------------------------
O43521_BCL2L11-09      -------------------------------------------------g
O43521_BCL2L11-14      -------------------------------------------------g
O43521_BCL2L11-04      aatggttatcttacgactgttacgttacattgtccgcctggtgtggagaa
O43521_BCL2L11-21      --------------------------------------------------
O43521_BCL2L11-19      --------------------------------------------------
O43521_BCL2L11-18      --------------------------------------------------
O43521_BCL2L11-12      --------------------------------------------------
O43521_BCL2L11-11      --------------------------------------------------
O43521_BCL2L11-10      --------------------------------------------------
O43521_BCL2L11-08      --------------------------------------------------
O43521_BCL2L11-06      --------------------------------------------------
O43521_BCL2L11-01      --------------------------------------------------
O43521_BCL2L11-05      aatggttatcttacgactgttacgttacattgtccgcctggtgtggagaa
O43521_BCL2L11-13      --------------------------------------------------
                                                                         

O43521_BCL2L11-16      --------
O43521_BCL2L11-02      --------
O43521_BCL2L11-15      --------
O43521_BCL2L11-03      --------
O43521_BCL2L11-23      --------
O43521_BCL2L11-07      --------
O43521_BCL2L11-22      --------
Q6JTU4_BCL2L11-01      agaaatag
O43521_BCL2L11-20      --------
O43521_BCL2L11-17      --------
O43521_BCL2L11-09      agaaatag
O43521_BCL2L11-14      agaaatag
O43521_BCL2L11-04      tgcattga
O43521_BCL2L11-21      --------
O43521_BCL2L11-19      --------
O43521_BCL2L11-18      --------
O43521_BCL2L11-12      --------
O43521_BCL2L11-11      --------
O43521_BCL2L11-10      --------
O43521_BCL2L11-08      --------
O43521_BCL2L11-06      --------
O43521_BCL2L11-01      --------
O43521_BCL2L11-05      tgcattga
O43521_BCL2L11-13      --------
                               

© 1998-2022Legal notice