Dataset for CDS BBC3 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q9BXH1_BBC3-04      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
B4DQK3_BBC3-01      ------------------------------------------------------------
Q9BXH1_BBC3-03      atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
                                                                                

Q9BXH1_BBC3-04      acgacgtgggtcccctgccagatttgt---------------------------------
B4DQK3_BBC3-01      -------------------------atggccccagggagcgccatggcccgcgcacgcca
Q9BXH1_BBC3-03      acgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
                                              *                                 

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
Q9BXH1_BBC3-03      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
Q9BXH1_BBC3-03      gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
Q9BXH1_BBC3-03      cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
Q9BXH1_BBC3-03      cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
Q9BXH1_BBC3-03      aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
Q9BXH1_BBC3-03      gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
                                                                                

Q9BXH1_BBC3-04      ------------------------------------------------------------
B4DQK3_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
Q9BXH1_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
                                                                                

Q9BXH1_BBC3-04      ---------------------------gagacaagaggagcagcagcggcaccgcccctc
B4DQK3_BBC3-01      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
Q9BXH1_BBC3-03      cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
                                               *********************************

Q9BXH1_BBC3-04      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
B4DQK3_BBC3-01      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
Q9BXH1_BBC3-03      accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
                    ************************************************************

Q9BXH1_BBC3-04      agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
B4DQK3_BBC3-01      agcccccgagatggagcccaattag-----------------------------------
Q9BXH1_BBC3-03      agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
                    *************************                                   

Q9BXH1_BBC3-04      gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
B4DQK3_BBC3-01      ------------------------------------------------------------
Q9BXH1_BBC3-03      gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
                                                                                

Q9BXH1_BBC3-04      atgtag
B4DQK3_BBC3-01      ------
Q9BXH1_BBC3-03      atgtag
                          

© 1998-2020Legal notice