Dataset for CDS BAD of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q92934_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-04      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
B4DZQ9_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-04      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
B4DZQ9_BAD-01      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-01      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-02      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-04      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
B4DZQ9_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-02      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      catggagaagggacttcct-----------------------------------------
Q92934_BAD-04      catggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
B4DZQ9_BAD-01      catg--------------------------------------------------------
Q92934_BAD-01      catg--------------------------------------------------------
Q92934_BAD-02      catg--------------------------------------------------------
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      ------------------------------------------------------------
Q92934_BAD-04      gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
B4DZQ9_BAD-01      ------------------------------------------------------------
Q92934_BAD-01      ------------------------------------------------------------
Q92934_BAD-02      ------------------------------------------------------------
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      ---cgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcga
Q92934_BAD-04      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg--agtcgcca
B4DZQ9_BAD-01      ------------------------gaggcgctggggctgtggagatccgg--agtcgcca
Q92934_BAD-01      ------------------------gaggcgctggggctgtggagatccgg--agtcgcca
Q92934_BAD-02      ------------------------gaggcgctggggctgtggagatccgg--agtcgcca
Q92934_BAD-05      ------------------------------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      gtcttccagtcctggtgggatcg--------gaacttgggcaggggaagctccgccccct
Q92934_BAD-04      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
B4DZQ9_BAD-01      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
Q92934_BAD-01      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
Q92934_BAD-02      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
Q92934_BAD-05      -------------------------------------atgggggaggagcccagcccctt
Q92934_BAD-06      -------------------------------------atgggggaggagcccagcccctt
                                                          *  ** * *** * ***** *

Q92934_BAD-03      cc-cagtgaccttcgctccacatcccgaaactccacccgttcccactgccctgggcagc-
Q92934_BAD-04      tcggggccgctcgcgctcggcgccccccaac-----------------ctctgggcagca
B4DZQ9_BAD-01      tcggggccgttcgcgctcggcgccccccaac-----------------ctctgggcagca
Q92934_BAD-01      tcggggccgctcgcgctcggcgccccccaac-----------------ctctgggcagca
Q92934_BAD-02      tcggggccgctcgcgctcggcgccccccaac-----------------ctctgggcagca
Q92934_BAD-05      tcggggccgctcgcgctcggcgccccccaac-----------------ctctgggcagca
Q92934_BAD-06      tcggggccgctcgcgctcggcgccccccaac-----------------ctctgggcagca
                    *   *       *****  *  ***  ***                 * ********* 

Q92934_BAD-03      catcttgaatatgggcggaagtacttccctcaggcctatgcaaaaagaggatccgtgctg
Q92934_BAD-04      cagc---gctatggccgcgag-------ctccggaggatga-------------------
B4DZQ9_BAD-01      cagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgtgg
Q92934_BAD-01      cagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgtgg
Q92934_BAD-02      cagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgtgg
Q92934_BAD-05      cagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgtgg
Q92934_BAD-06      cagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgtgg
                   ** *     ***** **  **       *** **   ***                    

Q92934_BAD-03      tctcctttggagggagg--------------------------------gctgacccaga
Q92934_BAD-04      ------------------------------------------------------------
B4DZQ9_BAD-01      actcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggc
Q92934_BAD-01      actcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggc
Q92934_BAD-02      actcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggc
Q92934_BAD-05      actcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggc
Q92934_BAD-06      actcctttaagaagggacttcctcgcccgaagagcgcgggc-------------------
                                                                               

Q92934_BAD-03      ttcccttccggtgcgtgtga----------------------------------------
Q92934_BAD-04      ------------------------------------------------------------
B4DZQ9_BAD-01      aaagccccaggcgcctgcgc----------------------------------------
Q92934_BAD-01      aaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaa
Q92934_BAD-02      aaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaa
Q92934_BAD-05      aaagctccagctggacgcga----------------------------------------
Q92934_BAD-06      ------------------------------------------------------------
                                                                               

Q92934_BAD-03      --------------------
Q92934_BAD-04      --------------------
B4DZQ9_BAD-01      -----------------taa
Q92934_BAD-01      gctccgccccctcccagtga
Q92934_BAD-02      gctccgccccctcccagtga
Q92934_BAD-05      --------------------
Q92934_BAD-06      --------------------
                                       

© 1998-2022Legal notice