Dataset for CDS BAD of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A8MXU7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
A8MXU7_BAD-04      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
B4DZQ9_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagagg
                   ************************************************************

A8MXU7_BAD-03      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
A8MXU7_BAD-04      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
B4DZQ9_BAD-01      ggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccag
                   ************************************************************

A8MXU7_BAD-03      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
A8MXU7_BAD-04      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
B4DZQ9_BAD-01      gccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccat
                   ************************************************************

A8MXU7_BAD-03      catggagaagggacttcct-----------------------------------------
A8MXU7_BAD-04      catggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
B4DZQ9_BAD-01      catg--------------------------------------------------------
                   ****                                                        

A8MXU7_BAD-03      ------------------------------------------------------------
A8MXU7_BAD-04      gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
B4DZQ9_BAD-01      ------------------------------------------------------------
                                                                               

A8MXU7_BAD-03      ---cgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcga
A8MXU7_BAD-04      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg--agtcgcca
B4DZQ9_BAD-01      ------------------------gaggcgctggggctgtggagatccgg--agtcgcca
                                           *   *** *  ** *   ** *** *   * *** *

A8MXU7_BAD-03      gtcttccagtcctggtgggatcg--------gaacttgggcaggggaagctccgccccct
A8MXU7_BAD-04      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
B4DZQ9_BAD-01      cagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctt
                       ***   ** *  ****  *        ***     *  ** * *** * ***** *

A8MXU7_BAD-03      cccagtgacctt---cgctccacatcccgaaactccacccgttcccactgccctgggcag
A8MXU7_BAD-04      tc--ggggccgctcgcgctcggcgccccccaac-----------------ctctgggcag
B4DZQ9_BAD-01      tc--ggggccgttcgcgctcggcgccccccaac-----------------ctctgggcag
                    *  * * **     *****  *  ***  ***                 * ********

A8MXU7_BAD-03      c-catcttgaatatgggcggaagtacttccctcaggcctatgcaaaaagaggatccgtgc
A8MXU7_BAD-04      cacagc---gctatggccgcgag-------ctccggaggatga-----------------
B4DZQ9_BAD-01      cacagc---gctatggccgcgag-------ctccggaggatgagtgacgag----tttgt
                   * ** *     ***** **  **       *** **   ***                  

A8MXU7_BAD-03      tgtctcctttggagggagg--------------------------------gctgaccca
A8MXU7_BAD-04      ------------------------------------------------------------
B4DZQ9_BAD-01      ggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcg
                                                                               

A8MXU7_BAD-03      gattcccttccggtgcgtgtga---
A8MXU7_BAD-04      -------------------------
B4DZQ9_BAD-01      gcaaagccccaggcgcctgcgctaa
                                            

© 1998-2020Legal notice