Dataset for CDS classical BH3-containing proteins of organism Hippocampus comes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2Y0E4_BAD-01      atggccgcaaacttcagcatatccgacagcgagtccgagccctctgagga
A0A3Q2YCX7_BMF-01      atgga---------------------------------------------
A0A3Q2YCX7_BMF-02      atgga---------------------------------------------

A0A3Q2Y0E4_BAD-01      ggtagaagaaggggacgacggccaaggagccgctgaaaaagagcaggagc
A0A3Q2YCX7_BMF-01      ---ggatgaggaggatgat-------------------------------
A0A3Q2YCX7_BMF-02      ---ggatgaggaggatgat-------------------------------
                           ** ** * *** **                                

A0A3Q2Y0E4_BAD-01      agtgcctccgccaaggcctccgcctcaccttgccggagctcccaat----
A0A3Q2YCX7_BMF-01      -gtgtttgagcc-agacccccac-------tgctggcgcaccacattcaa
A0A3Q2YCX7_BMF-02      -gtgtttgagcc-agacccccac-------tgctggcgcaccacattcaa
                        ***  *  *** ** ** ** *       *** ** ** **  **    

A0A3Q2Y0E4_BAD-01      ggaagcaatgtcggggcggatccggctcaactcggagtcccacgctttgg
A0A3Q2YCX7_BMF-01      ggagataaagt--gtgaggagcggg--caacacagacacc-------tgg
A0A3Q2YCX7_BMF-02      ggagataaagt--gtgaggagcggg--caacacagacacc-------tgg
                       ***   ** **  * * *** * **  **** * **  **       ***

A0A3Q2Y0E4_BAD-01      cagtgtcccg-----agaggaggagttccaggcc---agggtggacgagg
A0A3Q2YCX7_BMF-01      ccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagagg
A0A3Q2YCX7_BMF-02      ccccgtcccggcatcaaacaacggcatgctgccctgtggagtcgcagagg
                       *   ******     * *  * *   * * * **    * ** *  ****

A0A3Q2Y0E4_BAD-01      aggtcggcacacccaccgacgg-ggcgccg--ttccgggggcgctccaag
A0A3Q2YCX7_BMF-01      agccaagaccactcttctacggtaacgcaggttttcgattgcacttc---
A0A3Q2YCX7_BMF-02      agccaagaccactcttctacggtaacgcaggttttcgattgcacttc---
                       **    *  *** *  * ****   *** *  ** **   ** ** *   

A0A3Q2Y0E4_BAD-01      tcggctccccccgtgctatgggctgcgaaaaagtacggacggcagctgcg
A0A3Q2YCX7_BMF-01      ccggcccactttgaact---tgttggtgaacagga------ggagcgact
A0A3Q2YCX7_BMF-02      ccggcccactttgaact---tgttggtgaacagga------ggagcgact
                        **** * *   *  **    * **   ** ** *      * ***  * 

A0A3Q2Y0E4_BAD-01      gcgcatgagcgacgagttcgatagcctgatggacaaaggggagttgaagt
A0A3Q2YCX7_BMF-01      gcaagaaagcgac------------------gacggaatggagcagcaac
A0A3Q2YCX7_BMF-02      gcaagaaagcgac------------------gacggaatggagcagcaac
                       **     ******                  ***  *  ****  * *  

A0A3Q2Y0E4_BAD-01      tcaag-agcgccggcggca-catccagggccatccaccactccaaaacct
A0A3Q2YCX7_BMF-01      tccagcagcagcagcagcagcagcccgtggcacgcagca--tagaggcct
A0A3Q2YCX7_BMF-02      tccagcagcagcagcagcagcagcccgtggcacgcagca--tagaggcct
                       ** ** ***  * ** *** ** ** * * **  ** **     *  ***

A0A3Q2Y0E4_BAD-01      g-gtggagctacctcttcagccaccaggagacggag---ggcgagaacaa
A0A3Q2YCX7_BMF-01      gcgtcggtcagaaactccagctgattggagaccagtttcatcgggaacac
A0A3Q2YCX7_BMF-02      gcgtcggtcagaaactccagctgattggagaccagtttcatcgggaacac
                       * ** *  *     ** ****     ******         ** ***** 

A0A3Q2Y0E4_BAD-01      caacaac-----------aaccaccacgacaaccatgctaatcgtactga
A0A3Q2YCX7_BMF-01      ttacagctggtgagcaggaatcaacacaagcac---------------aa
A0A3Q2YCX7_BMF-02      ttacagctggtgagcaggaatcaacacaagcac---------------aa
                         *** *           ** ** *** *  **                *

A0A3Q2Y0E4_BAD-01      atag
A0A3Q2YCX7_BMF-01      ataa
A0A3Q2YCX7_BMF-02      ataa

© 1998-2022Legal notice