Dataset for CDS BCL2L11 of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G5BQZ0_BCL2L11-04      atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtgg
G5BQZ0_BCL2L11-02      atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtgg
G5BQZ0_BCL2L11-01      atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtgg
G5BQZ0_BCL2L11-03      atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtgg
                       **************************************************

G5BQZ0_BCL2L11-04      acaattgcaacctgctgagaggccgccccagctcaggcctggggccccta
G5BQZ0_BCL2L11-02      acaattgcaacctgctgagaggccgccccagctcaggcctggggccccta
G5BQZ0_BCL2L11-01      acaattgcaacctgctgagaggccgccccagctcaggcctggggccccta
G5BQZ0_BCL2L11-03      acaattgcaacctgctgagaggccgccccagctcaggcctggggccccta
                       **************************************************

G5BQZ0_BCL2L11-04      cctccctacagacggagcccca----------------------------
G5BQZ0_BCL2L11-02      cctccctacagacggagccccaaggtaatcccgaaggcagtcccgaagtc
G5BQZ0_BCL2L11-01      cctccctacagacggagccccaaggtaatcccgaaggcagtcccgaagtc
G5BQZ0_BCL2L11-03      cctccctacagacggagcccca----------------------------
                       **********************                            

G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      gaaggggaccgctgcccccacggcagcccgcagggcccgctggccccacc
G5BQZ0_BCL2L11-01      gaaggggaccgctgcccccacggcagcccgcagggcccgctggccccacc
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
G5BQZ0_BCL2L11-01      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
G5BQZ0_BCL2L11-01      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BQZ0_BCL2L11-04      --agacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
G5BQZ0_BCL2L11-02      acagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
G5BQZ0_BCL2L11-01      acagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
G5BQZ0_BCL2L11-03      --agacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
                         ************************************************

G5BQZ0_BCL2L11-04      aagtcctccttgccaggccttcaaccattatctcagtgcaatgg------
G5BQZ0_BCL2L11-02      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
G5BQZ0_BCL2L11-01      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
G5BQZ0_BCL2L11-03      aagtcctccttgccaggccttcaaccattatctcagtgcaatggcttcca
                       ********************************************      

G5BQZ0_BCL2L11-04      ------------------------------ggtacccagaga----gctt
G5BQZ0_BCL2L11-02      tgcggcagtctcaggctgaacctccggatatgcgcccagagatatggatt
G5BQZ0_BCL2L11-01      tgcggcagtctcaggctgaacctccggatatgcgcccagagatatggatt
G5BQZ0_BCL2L11-03      tgcggcagtctcaggctgaacctccggatatgcgcccagagatatggatt
                                                      *  ********    * **

G5BQZ0_BCL2L11-04      gcacag--------------------------------------------
G5BQZ0_BCL2L11-02      gcgcaggagttgcgacgcatcggagatgaatttaatgcctcttacccaag
G5BQZ0_BCL2L11-01      gcgcaggagttgcgacgcatcggagatgaatttaatgcctcttacccaag
G5BQZ0_BCL2L11-03      gcgcaggagttgcgacgcatcggagatgaatttaatgcctcttacccaag
                       ** ***                                            

G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      gagggtatttttgaataattaccaaccggccgaggaccacccccaaatgg
G5BQZ0_BCL2L11-01      gagggtatttttgaataattaccaaccggccgaggaccacccccaaatgg
G5BQZ0_BCL2L11-03      gagggtatttttgaataattaccaaccggccgaggaccacccccaaatgg
                                                                         

G5BQZ0_BCL2L11-04      -------------------------------------------------c
G5BQZ0_BCL2L11-02      ttatcttgcgactattacgctacattgtccgcctcgtgtggagaatgcac
G5BQZ0_BCL2L11-01      ttatcttgcgactattacgctacattgtccgcctcgtgtggagaatgcac
G5BQZ0_BCL2L11-03      ttatcttgcgactattacgctacattgtccgcctcgtgtggagaatgcac
                                                                        *

G5BQZ0_BCL2L11-04      tgt
G5BQZ0_BCL2L11-02      tga
G5BQZ0_BCL2L11-01      tga
G5BQZ0_BCL2L11-03      tga
                       ** 

© 1998-2020Legal notice