Dataset for CDS classical BH3-containing proteins of organism Gouania willdenowi

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5HAH2_BMF-01      atg------------gacgatgaggaagatgatgtgtttgagccagaccc
A0A8C5I9J2_BAD-01      ---------------------atggcagccaacttctctatttcagaca-
A0A8C5I9J2_BAD-02      atgatgccattttatgtcaaaatggcagccaacttctctatttcagaca-
                                              ** **   *  * * *    *****  

A0A8C5HAH2_BMF-01      cctctgctggcgcactgcgttcaaggagataaagtgcgaagac--cgggt
A0A8C5I9J2_BAD-01      -----gcgagtcagatccatcagaggaggtagaggaagaagataacccaa
A0A8C5I9J2_BAD-02      -----gcgagtcagatccatcagaggaggtagaggaagaagataacccaa
                            **  *     * * *   ***** ** **   *****   *    

A0A8C5HAH2_BMF-01      cacgcagacacctggtcctgccctggtacacagcggcatgctgccgtgtg
A0A8C5I9J2_BAD-01      cacgaaagcatcggattc--ctttacacctcagcctcaacctgcc---tg
A0A8C5I9J2_BAD-02      cacgaaagcatcggattc--ctttacacctcagcctcaacctgcc---tg
                       **** *  ** * * * *  *  *    * ****  **  *****   **

A0A8C5HAH2_BMF-01      gcgtcg----cagagga---------accaaggtcac-------------
A0A8C5I9J2_BAD-01      acttcggactaacaggacctggtcgtattagggtcaactccgagtccgtg
A0A8C5I9J2_BAD-02      acttcggactaacaggacctggtcgtattagggtcaactccgagtccgtg
                        * ***     * ****         *  * *****              

A0A8C5HAH2_BMF-01      tcttccac----------ggtaacgcaggttttcggctacactttcccgc
A0A8C5I9J2_BAD-01      tcctccactgtctccagagatgaggaagaggt--gggtacgcctacc---
A0A8C5I9J2_BAD-02      tcctccactgtctccagagatgaggaagaggt--gggtacgcctacc---
                       ** *****          * * * * **   *  ** *** * * **   

A0A8C5HAH2_BMF-01      acactttgaacttgttggggagcacc---aatcaagtccacc--------
A0A8C5I9J2_BAD-01      -gacggtgctccattcagagggcgctcgaagtcagctcccccttccctgt
A0A8C5I9J2_BAD-02      -gacggtgctccattcagagggcgctcgaagtcagctcccccttccctgt
                         **  **  *   *  * * ** *    * ***  *** **        

A0A8C5HAH2_BMF-01      ggagagcgaaga---gcagcgaaacaccatggagcacctgcccagg---c
A0A8C5I9J2_BAD-01      gggcagcgaagaaatacggccagcggctaagaaggatgagtgatgaattc
A0A8C5I9J2_BAD-02      gggcagcgaagaaatacggccagcggctaagaaggatgagtgatgaattc
                       **  ********    * ** *    * * * ** *   *    *    *

A0A8C5HAH2_BMF-01      ggccatctgtggcacacagcgtg------------gaggctcgcatcgga
A0A8C5I9J2_BAD-01      gacagtctgctggataaaggggaaatgaggaaggtgaggagtgcagggag
A0A8C5I9J2_BAD-02      gacagtctgctggataaaggggaaatgaggaaggtgaggagtgcagggag
                       * *  ****  * * * ** *              ****   ***  *  

A0A8C5HAH2_BMF-01      ca-gaagc---tccagctcattggagaccagtttcacagggaacacctgc
A0A8C5I9J2_BAD-01      cacgaagcagatgcaccactctaaaagctggt-------ggagctacctc
A0A8C5I9J2_BAD-02      cacgaagcagatgcaccactctaaaagctggt-------ggagctacctc
                       ** *****   * ** * *  *  *  *  **       *** *  *  *

A0A8C5HAH2_BMF-01      aacggtatcatcgaaaccaaaggaataatgggccggtatggtggcgcttg
A0A8C5I9J2_BAD-01      tttagtcaccaggaaatggaaggagagaacaaccaccacgacg-------
A0A8C5I9J2_BAD-02      tttagtcaccaggaaatggaaggagagaacaaccaccacgacg-------
                           **  *   ****   *****   *    **   * *  *       

A0A8C5HAH2_BMF-01      gccgcaaccctcctgggccttctttttgaccggggattcattgctggagg
A0A8C5I9J2_BAD-01      ---gccacacccccgagc--------------------------------
A0A8C5I9J2_BAD-02      ---gccacacccccgagc--------------------------------
                          ** ** * ** * **                                

A0A8C5HAH2_BMF-01      aggcggtgcaggacggaggtga
A0A8C5I9J2_BAD-01      -----gcacagaatag------
A0A8C5I9J2_BAD-02      -----gcacagaatag------
                            *  *** *  *      

© 1998-2022Legal notice