Dataset for CDS BAD of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I2Z8C7_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I2Z8C7_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2I2Z8C7_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
                       **************************************************

A0A2I2Z8C7_BAD-02      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I2Z8C7_BAD-01      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
A0A2I2Z8C7_BAD-03      tgcagagaggggcctgggccccagccccgcaggggacgggccctcaggct
                       **************************************************

A0A2I2Z8C7_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I2Z8C7_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A2I2Z8C7_BAD-03      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A2I2Z8C7_BAD-02      cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgt
A0A2I2Z8C7_BAD-01      cagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgt
A0A2I2Z8C7_BAD-03      cagcaggagcagccaaccagcagcagccatcatgg---------------
                       ***********************************               

A0A2I2Z8C7_BAD-02      ggagatccggagtcgccacagctcctaccccgcggggacggaggacgacg
A0A2I2Z8C7_BAD-01      ggagatccggagtcgccacagctcctaccccgcggggacggaggacgacg
A0A2I2Z8C7_BAD-03      --------------------------------------------------
                                                                         

A0A2I2Z8C7_BAD-02      aagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcg
A0A2I2Z8C7_BAD-01      aagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcg
A0A2I2Z8C7_BAD-03      --------------------------------------------------
                                                                         

A0A2I2Z8C7_BAD-02      ccccccaacctctgggcagcacagcgctatggccgcgagctccggaggat
A0A2I2Z8C7_BAD-01      ccccccaacctctgggcagcacagcgctatggccgcgagctccggaggat
A0A2I2Z8C7_BAD-03      --------------------------------------------------
                                                                         

A0A2I2Z8C7_BAD-02      gagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
A0A2I2Z8C7_BAD-01      gagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
A0A2I2Z8C7_BAD-03      --------------------------agaagggacttcctcgcccgaaga
                                                 ************************

A0A2I2Z8C7_BAD-02      gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtc
A0A2I2Z8C7_BAD-01      gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtc
A0A2I2Z8C7_BAD-03      gcgcaggcacagcaacgcagatgcggcaaagctccagctggacgcgagtc
                       **************************************************

A0A2I2Z8C7_BAD-02      ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctc
A0A2I2Z8C7_BAD-01      ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctc
A0A2I2Z8C7_BAD-03      ttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctc
                       **************************************************

A0A2I2Z8C7_BAD-02      ccagtga-------------------------------------------
A0A2I2Z8C7_BAD-01      ccagtga-------------------------------------------
A0A2I2Z8C7_BAD-03      ccagtgaccttcgctgcacatcccgaaactccacccgttcccactgccct
                       *******                                           

A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
A0A2I2Z8C7_BAD-03      gggcagccatcttgaatacgggcggaagtacttccctcaggcctatgcaa
                                                                         

A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
A0A2I2Z8C7_BAD-03      aaagaggatccgtgctgtctcctttggagggaaggctgacccagattccc
                                                                         

A0A2I2Z8C7_BAD-02      ---------------
A0A2I2Z8C7_BAD-01      ---------------
A0A2I2Z8C7_BAD-03      ttccggtgcgtgtga
                                      

© 1998-2020Legal notice