Dataset for CDS BCL2L11 of organism Gopherus evgoodei

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4VJX6_BCL2L11      atgaagcagacgcgtcgcgatcggggtttggccaggggcgggagctgggc
A0A8C4VJX6_BCL2L11      atgaagcagacgcgtcgcgatcggggtttggccaggggcgggagctgggc
                        **************************************************

A0A8C4VJX6_BCL2L11      ttggtggcggtggcgggtcggcgctctccgcagtgcctggataaacagcc
A0A8C4VJX6_BCL2L11      ttggtggcggtggcgggtcggcgctctccgcagtgcctggataaacagcc
                        **************************************************

A0A8C4VJX6_BCL2L11      cggcgctccggcgggggtggctgtgcccgcgctgggggggatttcacagg
A0A8C4VJX6_BCL2L11      cggcgctccggcgggggtggctgtgcccgcgctgggggggatttcacagg
                        **************************************************

A0A8C4VJX6_BCL2L11      catgtggcgcttggccgcaggcaggaaaaagaccaaatggcaaagcaacc
A0A8C4VJX6_BCL2L11      catgtggcgcttggccgcaggcaggaaaaagaccaaatggcaaagcaacc
                        **************************************************

A0A8C4VJX6_BCL2L11      ttctgatctaaattcagagtgcgacagagaaggtggacagtttcagtcaa
A0A8C4VJX6_BCL2L11      ttctgatctaaattcagagtgcgacagagaaggtggacagtttcagtcaa
                        **************************************************

A0A8C4VJX6_BCL2L11      ctgaaaggccaagtcaacctcagcatcttagacctggggcccctacctct
A0A8C4VJX6_BCL2L11      ctgaaaggccaagtcaacctcagcatcttagacctggggcccctacctct
                        **************************************************

A0A8C4VJX6_BCL2L11      atacaaacacagtatcaagacaggagtcctgcgcctatgagttgcgacaa
A0A8C4VJX6_BCL2L11      atacaaacacagtatcaa--------------------------------
                        ******************                                

A0A8C4VJX6_BCL2L11      gtccacgcagactccaagtcccccttgtcaagcctttaatcattatctaa
A0A8C4VJX6_BCL2L11      --------------------------------------------------
                                                                          

A0A8C4VJX6_BCL2L11      gtgcaatggcttccaggtgggagtctccctcaatacgtgaagacatgcag
A0A8C4VJX6_BCL2L11      --------gcttccaggtgggagtctccctcaatacgtgaagacatgcag
                                ******************************************

A0A8C4VJX6_BCL2L11      ccggaaatatggattgcacaggaactgcggcgtattggagatgagtttaa
A0A8C4VJX6_BCL2L11      ccggaaatatggattgcacaggaactgcggcgtattggagatgagtttaa
                        **************************************************

A0A8C4VJX6_BCL2L11      tgcttcctattgcccaagaaggggtttcttggataatccagcagtaaacc
A0A8C4VJX6_BCL2L11      tgcttcctattgcccaagaaggggtttcttggataatccagcagtaaacc
                        **************************************************

A0A8C4VJX6_BCL2L11      accaaattgttttgcgcctgttacgttatatcatccgcctcatttggaga
A0A8C4VJX6_BCL2L11      accaaattgttttgcgcctgttacgttatatcatccgcctcatttggaga
                        **************************************************

A0A8C4VJX6_BCL2L11      ctgcagtaa
A0A8C4VJX6_BCL2L11      ctgcagtaa
                        *********

© 1998-2022Legal notice