Dataset for CDS classical BH3-containing proteins of organism Gopherus agassizii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452J430_PMAIP1-      atg------------------ccgggaaagac---------cctgcgcaa
A0A452H3N6_BMF-01       atggatc---cccccaactacctggaagacgactattccagcctggacgg
A0A452IFQ4_BAD-01       atgtttcgcatccaggagttcccggacgagg--tgttc---ccggggcga
                        ***                  * **   *            ** *  *  

A0A452J430_PMAIP1-      g---------------------------------ggtgcgcag-------
A0A452H3N6_BMF-01       gctggacgatgacg--tgtttcactctgactttggactcacaggtcagcc
A0A452IFQ4_BAD-01       g--ggaaggaggcgcctgctcccccc--------gagtcgcag-------
                        *                                 *   * ***       

A0A452J430_PMAIP1-      -----------------------------------------cagaacccc
A0A452H3N6_BMF-01       tggtgagatgacccctcctggcattttcacacagaaccaatcctacagct
A0A452IFQ4_BAD-01       cgggga-----------------------------------cacacgccc
                                                                 *  *   * 

A0A452J430_PMAIP1-      gctctcccag----------------------cacaggaagctgtga---
A0A452H3N6_BMF-01       g-tctcctggggaggtttcaactgttccccctcacacactgctgtggtcc
A0A452IFQ4_BAD-01       g-gctccaag--------cagccagacacccccaca----gctgagg---
                        *  ****  *                      ****    **** *    

A0A452J430_PMAIP1-      -----------------cgcag----------------------------
A0A452H3N6_BMF-01       aggtatcaggcatgctgagcagcaggacaaggcaacccaaacactcagtc
A0A452IFQ4_BAD-01       ---------------tgcgaagccggataggg----tcagacaccccatc
                                          * **                            

A0A452J430_PMAIP1-      --------------------------------------------------
A0A452H3N6_BMF-01       catcctcttctactcaggatgtcatgtt--gccatgtggagtcactgaag
A0A452IFQ4_BAD-01       ------tctggagccagaagtgcaggatgagccaggtggggc--------

A0A452J430_PMAIP1-      -------------------------tgct---------------------
A0A452H3N6_BMF-01       agccccagagactcttctatgggaatgctgggtaccgtttacatgtcccc
A0A452IFQ4_BAD-01       -attccgggcacgttc--------acgctcagcacccccca-----tcct

A0A452J430_PMAIP1-      --------ctttgc---------------------------------aac
A0A452H3N6_BMF-01       ccagttggctttgcattgaatccgcacctccaagaggagcctcgggaagg
A0A452IFQ4_BAD-01       ttgggctgctatgcgtt-----------------atgggc----gggagc
                                ** ***                                 *  

A0A452J430_PMAIP1-      tacgcaaaat----------------------------------------
A0A452H3N6_BMF-01       tcagcgggaagcacttgctgaggttcagattgcacggaagttacagtgca
A0A452IFQ4_BAD-01       tgcgcaggatgag--tgacgagtttgatgtggcgctgcaggtgctg----
                        *  **   *                                         

A0A452J430_PMAIP1-      -----------------aggagatatatgcaacctgcagcagaag-----
A0A452H3N6_BMF-01       ttgcagaccagttccacaggctccacat-acagaggcatcagcagaacag
A0A452IFQ4_BAD-01       ccacgccccaagagtgcaggcacgacatcccagctccaccgggggaacag
                                         ***    * **   *    ** * *  *     

A0A452J430_PMAIP1-      -------------------------------attcttaacgttattacaa
A0A452H3N6_BMF-01       aaatcaagtgtggtggcagatccttctctttatacataacttggccttaa
A0A452IFQ4_BAD-01       c---------tggaaagagaccctcc-----aggcctggttggggcacag
                                                       *  * *           * 

A0A452J430_PMAIP1-      aactg---------ttctgcccaggaac--------------gtga
A0A452H3N6_BMF-01       atgtggaggtga--------acaggaaccacgtaggtcagaggtga
A0A452IFQ4_BAD-01       acccgcccgtgatgccctccccaggagctcc---------aagtga
                        *   *                ***** *              ****

© 1998-2020Legal notice