Dataset for CDS BMF of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2UCA0_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A3Q2UCA0_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A3Q2UCA0_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A3Q2UCA0_BMF-04      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A9XRH0_BMF-01          atggatcgccccagctacctggaagaggactattctagcctggatgggct

A0A3Q2UCA0_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A3Q2UCA0_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A3Q2UCA0_BMF-03      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A3Q2UCA0_BMF-04      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A9XRH0_BMF-01          ggacgatgacgtgtttcactctgatgactttggacttgca----------

A0A3Q2UCA0_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A3Q2UCA0_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A3Q2UCA0_BMF-03      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A3Q2UCA0_BMF-04      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A9XRH0_BMF-01          --------------------------------------------------

A0A3Q2UCA0_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A3Q2UCA0_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A3Q2UCA0_BMF-03      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A3Q2UCA0_BMF-04      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A9XRH0_BMF-01          --------------------------------------------------

A0A3Q2UCA0_BMF-01      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A3Q2UCA0_BMF-02      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A3Q2UCA0_BMF-03      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A0A3Q2UCA0_BMF-04      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgt
A9XRH0_BMF-01          --------------------------------------------------

A0A3Q2UCA0_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A3Q2UCA0_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A3Q2UCA0_BMF-03      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A3Q2UCA0_BMF-04      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A9XRH0_BMF-01          --------------------------------------------------

A0A3Q2UCA0_BMF-01      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A3Q2UCA0_BMF-02      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A3Q2UCA0_BMF-03      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A3Q2UCA0_BMF-04      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A9XRH0_BMF-01          ---------------gggaatgctggttaccgcttacatgtccctccagt

A0A3Q2UCA0_BMF-01      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A0A3Q2UCA0_BMF-02      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A0A3Q2UCA0_BMF-03      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A0A3Q2UCA0_BMF-04      tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
A9XRH0_BMF-01          tggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc

A0A3Q2UCA0_BMF-01      gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A0A3Q2UCA0_BMF-02      gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A0A3Q2UCA0_BMF-03      gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A0A3Q2UCA0_BMF-04      gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca
A9XRH0_BMF-01          gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgca

A0A3Q2UCA0_BMF-01      gaccagttccaccggctccacatacagcgggtagggtgtttccacagggg
A0A3Q2UCA0_BMF-02      gaccagttccaccggctccacatacagcgggtagggtgtttccacagggg
A0A3Q2UCA0_BMF-03      gaccagttccaccggctccacatacagc------ggcatcagcagaacag
A0A3Q2UCA0_BMF-04      gaccagttccaccggctccacatacagc------ggcatcagcagaacag
A9XRH0_BMF-01          gaccagttccaccggctccacatacagc------ggcatcagcagaacag
                       ****************************      **  *   ** *   *

A0A3Q2UCA0_BMF-01      aa---------ggtggggtctttcttatctaagagtggtgctccagaaga
A0A3Q2UCA0_BMF-02      aa---------ggtggggtctttcttatctaagagtggtgctccagaaga
A0A3Q2UCA0_BMF-03      aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
A0A3Q2UCA0_BMF-04      aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
A9XRH0_BMF-01          aaatcaagtgtggtggcagctttttctctt-----------tctacacaa
                       **         *****   **** *    *           ** * *  *

A0A3Q2UCA0_BMF-01      c-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A0A3Q2UCA0_BMF-02      c-tggctccaggcttcg-gctaagcaggctgttgcctaaggcagccgca-
A0A3Q2UCA0_BMF-03      cttggccttaaacgtggaggcgaacagg--------------aaccgcac
A0A3Q2UCA0_BMF-04      cttggccttaaacgtggaggcgaacagg--------------aaccgcac
A9XRH0_BMF-01          cttggccttaaacgtggaggcgaacagg--------------aaccgcac
                       * ****   *  * * * *   * ****              * ***** 

A0A3Q2UCA0_BMF-01      --ggctaccggcagtga
A0A3Q2UCA0_BMF-02      --ggctaccggcagtga
A0A3Q2UCA0_BMF-03      tggg----cagaggtga
A0A3Q2UCA0_BMF-04      tggg----cagaggtga
A9XRH0_BMF-01          tggg----cagaggtga
                         **    * *  ****

© 1998-2022Legal notice