Dataset for CDS classical BH3-containing proteins of organism Fundulus heteroclitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2PJX9_BMF-01       atgga-------------ggatgaggaggatgatgtgtttg---------
A0A3Q2PJX9_BMF-03       atgga-------------ggatgaggaggatgatgtgtttg---------
A0A3Q2PJX9_BMF-02       atgga-------------ggatgaggaggatgatgtgtttg---------
A0A3Q2QC80_BAD-01       atgtcgccaagtagcagcagccatattggatgctttccttacccactgag
A0A3Q2SZH6_BCL2L11      atggt-----------------------gacgctctgttcatccaacaga
                        ***                         ** * * *  *           

A0A3Q2PJX9_BMF-01       -agccagatcc---caa--------------------------------c
A0A3Q2PJX9_BMF-03       -agccagatcc---caa--------------------------------c
A0A3Q2PJX9_BMF-02       -agccagatcc---caa--------------------------------c
A0A3Q2QC80_BAD-01       aaatcagatcaactcgagtccaagttgcactttcatttctggtttgaatt
A0A3Q2SZH6_BCL2L11      ccgccaaatctgcgcga---------------------------tggctc
                            ** ***    * *                                 

A0A3Q2PJX9_BMF-01       tgctggcgcacacccttcagggagataa--------------------ag
A0A3Q2PJX9_BMF-03       tgctggcgcacacccttcagggagataa--------------------ag
A0A3Q2PJX9_BMF-02       tgctggcgcacacccttcagggagataa--------------------ag
A0A3Q2QC80_BAD-01       ttccgaattcgtgtcttccagatgatacgatggcggccaagtttact-at
A0A3Q2SZH6_BCL2L11      taccgaagtaacgccaccagaggggaccggaggagacccagcatcctcag
                        * * *         *  *     *                        * 

A0A3Q2PJX9_BMF-01       tgcgaagacc--------------------------ggggcacgcagacg
A0A3Q2PJX9_BMF-03       tgcgaagacc--------------------------ggggcacgcagacg
A0A3Q2PJX9_BMF-02       tgcgaagacc--------------------------ggggcacgcagacg
A0A3Q2QC80_BAD-01       ttcggac----------------------------agcgactcggagcca
A0A3Q2SZH6_BCL2L11      cgcgaacaccacgtttgtccaagcacagggaggggagctgcgcgcagccg
                          ** *                              *   * ** ** * 

A0A3Q2PJX9_BMF-01       cccggtcctg----------------------------------------
A0A3Q2PJX9_BMF-03       cccggtcctg----------------------------------------
A0A3Q2PJX9_BMF-02       cccggtcctg----------------------------------------
A0A3Q2QC80_BAD-01       ccagaagaagt---------cgaggaagaaggaaacgatcag--------
A0A3Q2SZH6_BCL2L11      ccgggcgccgttaccgccgccggaggaggaggaggggagccggactcgga
                        ** *     *                                        

A0A3Q2PJX9_BMF-01       --------------ccctggcaccgaacaacg------------------
A0A3Q2PJX9_BMF-03       --------------ccctggcaccgaacaacg------------------
A0A3Q2PJX9_BMF-02       --------------ccctggcaccgaacaacg------------------
A0A3Q2QC80_BAD-01       --------------ccagcagacggaaaagtg------------------
A0A3Q2SZH6_BCL2L11      ctcgccgccccgctccataagcccgaacagtttagacgtctttcaaagaa
                                      **      * *** *                     

A0A3Q2PJX9_BMF-01       ------------------------------------------gcatgctg
A0A3Q2PJX9_BMF-03       ------------------------------------------gcatgctg
A0A3Q2PJX9_BMF-02       ------------------------------------------gcatgctg
A0A3Q2QC80_BAD-01       --------------------------------------------gagccg
A0A3Q2SZH6_BCL2L11      ggtcgatttttcgcaaatccagcggatacttctcctttgactgcgagtcg
                                                                      *  *

A0A3Q2PJX9_BMF-01       ccctgcg-gcgttgcg--------------gaggagcccagacaactgtt
A0A3Q2PJX9_BMF-03       ccctgcg-gcgttgcg--------------gaggagcccagacaactgtt
A0A3Q2PJX9_BMF-02       ccctgcg-gcgttgcg--------------gaggagcccagacaactgtt
A0A3Q2QC80_BAD-01       ctccgccagcgccacgccctcacc---cttcctgagctcagatca-----
A0A3Q2SZH6_BCL2L11      ctgc-cgagcactccgctctctccgcacccactgacggctgacaa-----
                        *    *  **    **                 **   * **  *     

A0A3Q2PJX9_BMF-01       ctacggtaacgcaggttttcgattgcact-----tcccagcacattttga
A0A3Q2PJX9_BMF-03       ctacggtaacgcaggttttcgattgcact-----tcccagcacattttga
A0A3Q2PJX9_BMF-02       ctacggtaacgcaggttttcgattgcact-----tcccagcacattttga
A0A3Q2QC80_BAD-01       ----gggcatggccggatcagactgaactcggagtccca-----------
A0A3Q2SZH6_BCL2L11      ----agccacg-------cagactgcc-----agcccca-----------
                             *  * *         ** **          ****           

A0A3Q2PJX9_BMF-01       gcttgtcggggattttgacgcgaggcgacaggagga---gcagaacagga
A0A3Q2PJX9_BMF-03       gcttgtcggggattttgacgcgaggcgacaggagga---gcagaacagga
A0A3Q2PJX9_BMF-02       gcttgtcggggattttgacgcgaggcgacaggagga---gcagaacagga
A0A3Q2QC80_BAD-01       -c--gcc------tccaccatctccagagaggaggagctgcagggcaggg
A0A3Q2SZH6_BCL2L11      -ccggccaggtgatgaaccacgccctgcagcgaatggctgcggagcacgg
                         *  * *      *    *       *    **      ** *  ** * 

A0A3Q2PJX9_BMF-01       tgga--------------gccgttacccc------tgcaccagccggcag
A0A3Q2PJX9_BMF-03       tgga--------------gccgttacccc------tgcaccagccggcag
A0A3Q2PJX9_BMF-02       tgga--------------gccgttacccc------tgcaccagccggcag
A0A3Q2QC80_BAD-01       cgga-------ggaggaggccgggacccccaccgaggggcttccattca-
A0A3Q2SZH6_BCL2L11      tggacagccagcaagaatactggggctgc-----acggacactcctttag
                         ***               * *   *  *       *  *   *    * 

A0A3Q2PJX9_BMF-01       cgctcagcttggaggc-ctgca----------------------------
A0A3Q2PJX9_BMF-03       cgctcagcttggaggc-ctgca----------------------------
A0A3Q2PJX9_BMF-02       cgctcagcttggaggc-ctgca----------------------------
A0A3Q2QC80_BAD-01       ----------ggaaccgctccaattcggctcctccggcgctgtgggcagc
A0A3Q2SZH6_BCL2L11      cgcgcggcagggaaacgcagca---------------cgggatatgcagc
                                  ***  * *  **                            

A0A3Q2PJX9_BMF-01       ---------tcgggcagaagcttcagctgataggcgac--------cagt
A0A3Q2PJX9_BMF-03       ---------tcgggcagaagcttcagctgataggcgac--------cagt
A0A3Q2PJX9_BMF-02       ---------tcgggcagaagcttcagctgataggcgac--------cagt
A0A3Q2QC80_BAD-01       caagaag-tacgggcggcagcttcgcaggatgagcgacgagttcggcagc
A0A3Q2SZH6_BCL2L11      cggaacgttttggtcgtcaactccgggctattggcgatgaatacaacaat
                                   ** *   * ** *     **  ****         **  

A0A3Q2PJX9_BMF-01       ttcatc---------------gggaacacttacaacag------------
A0A3Q2PJX9_BMF-03       ttcatc---------------gggaacacttacaacag------------
A0A3Q2PJX9_BMF-02       ttcatc---------------gggaacacttacaacagagaggctctttt
A0A3Q2QC80_BAD-01       ctgctcgataaaggggagttgaggaaggtgagcagcg-------------
A0A3Q2SZH6_BCL2L11      cacctc-----atgagaatggcgggacgacaacaacgaga----------
                            **                ** *      ** *              

A0A3Q2PJX9_BMF-01       -----tatcatcaaaaccaaaggaat--------------cagg-ggccg
A0A3Q2PJX9_BMF-03       -----tatcatcaaaaccaaaggaat--------------cagg-ggccg
A0A3Q2PJX9_BMF-02       cggtcttctcttgctgcaggagaggt--------------tgggaaacca
A0A3Q2QC80_BAD-01       ------ctgggacgaacagacccattcaccactc------caggagctgg
A0A3Q2SZH6_BCL2L11      -----tatggtccctctaaacctgat-gccacacatccagcaggagcctg
                                                 *                **      

A0A3Q2PJX9_BMF-01       ctgtggtggcgcatgactgcagctcttctcagcctcctgctt-gataggg
A0A3Q2PJX9_BMF-03       ctgtggtggcgcatgactgcagctcttctcagcctcctgctt-gataggg
A0A3Q2PJX9_BMF-02       atgtact---acacaa--acgtctactcacagtgtccaacct-gctggct
A0A3Q2QC80_BAD-01       -----------tggaactacctct----tcagccaccagg--agacgga-
A0A3Q2SZH6_BCL2L11      ttgccatgctctgtgtcggcctct----tgctcctcctgattggacgaat
                                           *  **           **      *      

A0A3Q2PJX9_BMF-01       ggtttgttgctggaagag-----------gtggag----------ccgga
A0A3Q2PJX9_BMF-03       ggtttgttgctggaagag-----------gtggag----------ccgga
A0A3Q2PJX9_BMF-02       cgcaaattgcctgagtcg---------ccttgctg----------ccgaa
A0A3Q2QC80_BAD-01       -----------gggagagaacagcca-ccatgaaaaccacgccccccgca
A0A3Q2SZH6_BCL2L11      aatgtacttgcaaggcagtacaaacagccatga------------ccact
                                         *            **             **   

A0A3Q2PJX9_BMF-01       cggagg---------------------------tga
A0A3Q2PJX9_BMF-03       cggagg---------------------------tga
A0A3Q2PJX9_BMF-02       ctgctgattctctgtgagttccctacgcttctctga
A0A3Q2QC80_BAD-01       ccgag----------------------------tag
A0A3Q2SZH6_BCL2L11      ctcagg-------------------------tttag
                        *                                *  

© 1998-2020Legal notice