Dataset for CDS classical BH3-containing proteins of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8ZIE7_BMF-01       at------------------------------------------------
A0A3P8YI30_BAD-01       atgttttattcattttgtcactctccctgtgatgagtgtttcctaacaat
A0A3P8YI30_BAD-02       at------------------------------------------------
A0A3P8XIA2_BCL2L11      atgttt--------------------------------------------
A0A3P8Y761_BAD-01       atg-----------------------------------------------
A0A3P8Y761_BAD-02       atg-----------------------------------------------
                        **                                                

A0A3P8ZIE7_BMF-01       --------------------------------------------------
A0A3P8YI30_BAD-01       atgtaatgcctttggtcagtgtttattaaggatggatgttttttctcttc
A0A3P8YI30_BAD-02       --------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8Y761_BAD-01       --------------------------------------------------
A0A3P8Y761_BAD-02       --------------------------------------------------
                                                                          

A0A3P8ZIE7_BMF-01       -ggaggat------------gaggaggatgatgtgtttgagccagactcc
A0A3P8YI30_BAD-01       aggctttt------------aaaatggatcac-------actcaggattg
A0A3P8YI30_BAD-02       -ggctttt------------aaaatggatcac-------actcaggattg
A0A3P8XIA2_BCL2L11      -gattcgtccagaccac---aaaatcggtccaatggcacgaccaccctaa
A0A3P8Y761_BAD-01       -g------------------aaaat---------attttcactatat---
A0A3P8Y761_BAD-02       -ggctgttccacaccctacagaaatgggatatcgacttctaccattctgc
                         *                   *                     *      

A0A3P8ZIE7_BMF-01       tactgctggca---------------------------------------
A0A3P8YI30_BAD-01       tgtgggtgaca---------------------------------------
A0A3P8YI30_BAD-02       tgtgggtgaca---------------------------------------
A0A3P8XIA2_BCL2L11      ttgggagagggaaaatcggagagtcgcatccctgtggcggagcaacctcg
A0A3P8Y761_BAD-01       ---------cagacaccgaa------------------------------
A0A3P8Y761_BAD-02       ctcacaccacaggaaccggagataggctcctgccctacgggct-------
                                                                          

A0A3P8ZIE7_BMF-01       ----------------cacagcctccagggag-------ataaagtacga
A0A3P8YI30_BAD-01       ----------------------ttccagaaaacataaacgaaaaatatga
A0A3P8YI30_BAD-02       ----------------------ttccagaaaacataaacgaaaaatatga
A0A3P8XIA2_BCL2L11      agttccaaactgt---cagattacccccagtcctgcgaagggaacca---
A0A3P8Y761_BAD-01       ---tctgaatcct---cagatgtagaagaaacc-aaaaagga----atgg
A0A3P8Y761_BAD-02       -gttctgcctcataaccataggaactagagatg-gtacaggagcctatgg
                                                                      *   

A0A3P8ZIE7_BMF-01       ---ggac-----aggggc--------acccagactcccacaactgctctg
A0A3P8YI30_BAD-01       tttggaccacttaggaactacacattacccagaatttcagttctgtaata
A0A3P8YI30_BAD-02       tttggaccacttaggaactacacattacccagaatttcagttctgtaata
A0A3P8XIA2_BCL2L11      -----gcagtcacggggagga-----ataatgatgccgacgaatagtctg
A0A3P8Y761_BAD-01       attg-ccggacaggggaagac--------tggaagccgattaggcctctc
A0A3P8Y761_BAD-02       gctgttctggcttagaaacac-----acatatccacccactcatcctctg
                              *       *                       *         * 

A0A3P8ZIE7_BMF-01       gcactgct--------caatgac----------------------atgct
A0A3P8YI30_BAD-01       cctccactaatacaagcaataga----------------------acact
A0A3P8YI30_BAD-02       cctccactaatacaagcaataga----------------------acact
A0A3P8XIA2_BCL2L11      c--ttggt-ttccagtcgaggtcgcctcttttcagaacaacatccacgtc
A0A3P8Y761_BAD-01       ccttaacc-taccaggcgagggc---------------------------
A0A3P8Y761_BAD-02       ctcttttt-ttataggcgagggc---------------------------
                                        * *                               

A0A3P8ZIE7_BMF-01       accctg----------cagattggaccaggatcc-----cagaccactgt
A0A3P8YI30_BAD-01       accaggtgtacgcgtccggctctactcggaatcc-----caggt--gtgt
A0A3P8YI30_BAD-02       accaggtgtacgcgtccggctctactcggaatcc-----caggt--gtgt
A0A3P8XIA2_BCL2L11      ctccagtggatatttttcgttcgactgcgactctattccaagctcgccac
A0A3P8Y761_BAD-01       ------cggataag----gttaaactctgaatct-----caggtcttcgc
A0A3P8Y761_BAD-02       ------cggataag----gttaaactctgaatct-----caggtcttcgc
                                          * *       *  **       **        

A0A3P8ZIE7_BMF-01       tct----------acggt-------------aacgcaggcttt-------
A0A3P8YI30_BAD-01       tcc----------caggttggcagacaggacaacacagagttt-------
A0A3P8YI30_BAD-02       tcc----------caggttggcagacaggacaacacagagttt-------
A0A3P8XIA2_BCL2L11      tactaagaaataacaagtcgacacaga----ctc--cgagcccatctagt
A0A3P8Y761_BAD-01       tac--------atctggtggggagagg----agcggggagctc-------
A0A3P8Y761_BAD-02       tac--------atctggtggggagagg----agcggggagctc-------
                        *               **               *   *            

A0A3P8ZIE7_BMF-01       c-gatt---------gcact-----ttccggcccagtttgagtgcgttgg
A0A3P8YI30_BAD-01       caggtt---------gcaatgactcctacggaggagagtgggggcgatgc
A0A3P8YI30_BAD-02       caggtt---------gcaatgactcctacggaggagagtgggggcgatgc
A0A3P8XIA2_BCL2L11      caagttattactcacgcaat----------gaggcgcttgtctaagccac
A0A3P8Y761_BAD-01       cagggtttggggcaagggtt----------gaactgtgtg-----gccac
A0A3P8Y761_BAD-02       cagggtttggggcaagggtt----------gaactgtgtg-----gccac
                        *    *         *   *          *    *  **     *    

A0A3P8ZIE7_BMF-01       aga-----cccg---------------gggcct----cagcagcgtc---
A0A3P8YI30_BAD-01       agcaccgttccg---------------gggccggtcacagtctgctc---
A0A3P8YI30_BAD-02       agcaccgttccg---------------gggccggtcacagtctgctc---
A0A3P8XIA2_BCL2L11      aagacacctggcgaggttatgaagcgtggcccaccccccaccacccctat
A0A3P8Y761_BAD-01       agaaggactacc----ttttag-----ggtccgctcccagtcagccc---
A0A3P8Y761_BAD-02       agaaggactacc----ttttag-----ggtccgctcccagtcagccc---
                        *                          ** **     *        *   

A0A3P8ZIE7_BMF-01       ---cccaggcggtgagaggggggatggagcac------------------
A0A3P8YI30_BAD-01       ---cccctgcgctgtgggctgcaaaaaaatat------------------
A0A3P8YI30_BAD-02       ---cccctgcgctgtgggctgcaaaaaaatat------------------
A0A3P8XIA2_BCL2L11      agaccacggccaccaccaatagcgggggacatgcggccggaaatactgat
A0A3P8Y761_BAD-01       ---ccccggccctctgggctgccaagagatat------------------
A0A3P8Y761_BAD-02       ---ccccggccctctgggctgccaagagatat------------------
                           **   **                    *                   

A0A3P8ZIE7_BMF-01       -ccccaacagctgccccagcagccagtagcccgttgcattgg--------
A0A3P8YI30_BAD-01       -ggctgccagctg-------aggaggatgagtgatgaatttg--------
A0A3P8YI30_BAD-02       -ggctgccagctg-------aggaggatgagtgatgaatttg--------
A0A3P8XIA2_BCL2L11      cggtcaggagctt-------cagcgcattggagatgagtttaacaacctg
A0A3P8Y761_BAD-01       -ggacggcagctg-------cgacgcatgagtgacgagttcg--------
A0A3P8Y761_BAD-02       -ggacggcagctg-------cgacgcatgagtgacgagttcg--------
                                ****                    *  *  **          

A0A3P8ZIE7_BMF-01       ---acagaagctccaactcattggtgaccagtttcatgaagaacatctgc
A0A3P8YI30_BAD-01       ---acacctggcttgacaaaggggagccca-------agaga------gg
A0A3P8YI30_BAD-02       ---acacctggcttgacaaaggggagccca-------agaga------gg
A0A3P8XIA2_BCL2L11      ttcatacatgggcgtct-tggggcaa--gaaatggtc--agg--------
A0A3P8Y761_BAD-01       ---atacgtggctggataaagggcaaatgaagcgggtgaaga--------
A0A3P8Y761_BAD-02       ---atacgtggctggataaagggcaaatgaagcgggtgaaga--------
                           * *   *            *      *         **         

A0A3P8ZIE7_BMF-01       aactgtatcacagaaaccaaaggaacctgaggcccctgtg---------g
A0A3P8YI30_BAD-01       aattatcccaggaagagcaaagcag--------gtctaca---------g
A0A3P8YI30_BAD-02       aattatcccaggaagagcaaagcag--------gtctaca---------g
A0A3P8XIA2_BCL2L11      -----ttgc--------ccaagca------aaccttcctcagatgcacca
A0A3P8Y761_BAD-01       -----gtgcaggagcagccaaacagatgacaacatccccgagctg----g
A0A3P8Y761_BAD-02       -----gtgcaggagcagccaaacagatgacaacatccccgagctg----g
                                *        * **  *                          

A0A3P8ZIE7_BMF-01       tggcgcctggcctcggctctgctcactctgctgt-----gggagcag---
A0A3P8YI30_BAD-01       agga---------tggttctcgttcctctggagtccaaaggaagctg---
A0A3P8YI30_BAD-02       agga---------tggttctcgttcctctggagtccaaaggaagctg---
A0A3P8XIA2_BCL2L11      agaa----------------cctgcctttct------------actg---
A0A3P8Y761_BAD-01       tggg----------------ccttcctgttcagccacaaggaaactgaga
A0A3P8Y761_BAD-02       tggg----------------ccttcctgttcagccacaaggaaactgaga
                         *                    *  ** *               * *   

A0A3P8ZIE7_BMF-01       -----gaggcc----------------gtggctggaggcgggagagccg-
A0A3P8YI30_BAD-01       -----aaggca----------------gggactga---------------
A0A3P8YI30_BAD-02       -----aaggca----------------gggactga---------------
A0A3P8XIA2_BCL2L11      -tggatgggcctcctgattggtcgactattac-------agatcatttgg
A0A3P8Y761_BAD-01       cagaaaagacccccaaccttatc----attactgaaccaagatcttctg-
A0A3P8Y761_BAD-02       cagaaaagacccccaaccttatc----attactgaaccaagatcttctg-
                               * *                     *                  

A0A3P8ZIE7_BMF-01       -ggtggaggtga
A0A3P8YI30_BAD-01       ------------
A0A3P8YI30_BAD-02       ------------
A0A3P8XIA2_BCL2L11      cggagaagataa
A0A3P8Y761_BAD-01       -------agtag
A0A3P8Y761_BAD-02       -------agtag
                                    

© 1998-2022Legal notice