Dataset for CDS classical BH3-containing proteins of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8Y761_BAD-01       at------------------------------------------------
A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      atgtttgattcgtccagaccacaaaatcggtccaatggcacgaccaccct
A0A3P9A5G8_BAD-02       atggcttttaa---------------------------------------
A0A3P9A5G8_BAD-01       atggcttttaa---------------------------------------
A0A3P8ZIE7_BMF-01       atggaggatga---------------------------------------

A0A3P8Y761_BAD-01       -------------------ggaaaatattttcactatatcaga-----ca
A0A3P8XIA2_BCL2L11      -------------------agagagtc-----------------------
A0A3P8XIA2_BCL2L11      aattgggagagggaaaatcggagagtcgcatccctgtggcggagcaacct
A0A3P9A5G8_BAD-02       -------------------aatggatcac-------actcagg-------
A0A3P9A5G8_BAD-01       -------------------aatggatcac-------actcagg-------
A0A3P8ZIE7_BMF-01       -------------------ggaggatgatgtgtttgagccaga-------

A0A3P8Y761_BAD-01       ccgaatctgaatcctcaga-------------tgtagaagaaa-------
A0A3P8XIA2_BCL2L11      ----------------------------ttcctgcgaagggaa-------
A0A3P8XIA2_BCL2L11      cgagttccaaactgtcagattacccccagtcctgcgaagggaa-------
A0A3P9A5G8_BAD-02       ----------------------------attgtgtgggtgaca------t
A0A3P9A5G8_BAD-01       ----------------------------attgtgtgggtgaca------t
A0A3P8ZIE7_BMF-01       ----------------------------ctcctactgctggcacacagcc
                                                        *      *  *       

A0A3P8Y761_BAD-01       -ccaaaaaggaatggattgccggaca-ggggaagactg--gaagccgatt
A0A3P8XIA2_BCL2L11      -ccag---------------cagtcacggggaggaataatgatgccgacg
A0A3P8XIA2_BCL2L11      -ccag---------------cagtcacggggaggaataatgatgccgacg
A0A3P9A5G8_BAD-02       tccagaaaa-----------cataaacgaaaaatatgatttggaccactt
A0A3P9A5G8_BAD-01       tccagaaaa-----------cataaacgaaaaatatgatttggaccactt
A0A3P8ZIE7_BMF-01       tccagggag------------------ataaagtacga---ggac-----
                         ***                           *  *         *     

A0A3P8Y761_BAD-01       aggcct------ctcccttaacctaccaggcgagggc-------------
A0A3P8XIA2_BCL2L11      aatagt------ctgcttgg--tttccagtcgaggtcgcctcttttcaga
A0A3P8XIA2_BCL2L11      aatagt------ctgcttgg--tttccagtcgaggtcgcctcttttcaga
A0A3P9A5G8_BAD-02       aggaactacacattacccagaatttcagttctgtaatacctccactaata
A0A3P9A5G8_BAD-01       aggaactacacattacccagaatttcagttctgtaatacctccactaata
A0A3P8ZIE7_BMF-01       aggggc--------acccagactcccacaactgctctggcactgct----
                        *              *         *    *                   

A0A3P8Y761_BAD-01       ----------------------cggataag----gttaaactctgaatct
A0A3P8XIA2_BCL2L11      acaacatccacgtcct--ccagtggatatttttcgttcgactgcgactct
A0A3P8XIA2_BCL2L11      acaacatccacgtcct--ccagtggatatttttcgttcgactgcgactct
A0A3P9A5G8_BAD-02       caagcaatagaacactaccaggtgtacgcgtccggctctactcggaatcc
A0A3P9A5G8_BAD-01       caagcaatagaacactaccaggtgtacgcgtccggctctactcggaatcc
A0A3P8ZIE7_BMF-01       ----caatgacatgctaccctg----------cagattggaccaggatcc
                                                          * *       *  ** 

A0A3P8Y761_BAD-01       ----caggt--cttcgctacatctggtggggagaggagcggggagctcca
A0A3P8XIA2_BCL2L11      attccaag----ctcgccactact-----aagaaataacaagtcgacaca
A0A3P8XIA2_BCL2L11      attccaag----ctcgccactact-----aagaaataacaagtcgacaca
A0A3P9A5G8_BAD-02       ----caggt--gtgttcccaggttggcagacaggacaacacagagtttca
A0A3P9A5G8_BAD-01       ----caggt--gtgttcccaggttggcagacaggacaacacagagtttca
A0A3P8ZIE7_BMF-01       ----cagaccactgttctacggt-------------aacgcaggctttc-
                            **          *                   * *         * 

A0A3P8Y761_BAD-01       gg------------gtttggggcaa--gggttgaactgtgtggccacaga
A0A3P8XIA2_BCL2L11      ga------------ctccgagcccatctagtcaagttat-tactcacgca
A0A3P8XIA2_BCL2L11      ga------------ctccgagcccatctagtcaagttat-tactcacgca
A0A3P9A5G8_BAD-02       ggttgcaatgactcctacggaggagagtgggggcgatgc-----------
A0A3P9A5G8_BAD-01       ggttgcaatgactcctacggaggagagtgggggcgatgc-----------
A0A3P8ZIE7_BMF-01       gattgcact-----ttccggcccagtttgagtgcgttgg-----------
                        *              *  *                 *             

A0A3P8Y761_BAD-01       aggactacctttt----------------------------------agg
A0A3P8XIA2_BCL2L11      atgaggc-------------------------------------------
A0A3P8XIA2_BCL2L11      atgaggcgcttgtctaagccacaagacacctggcgaggttatgaagcgtg
A0A3P9A5G8_BAD-02       ---agcaccgttc----------------------------------cgg
A0A3P9A5G8_BAD-01       ---agcaccgttc----------------------------------cgg
A0A3P8ZIE7_BMF-01       ---aga-----cc----------------------------------cgg

A0A3P8Y761_BAD-01       gtccgctcccagtcagccc------ccccggccctctgggctgccaagag
A0A3P8XIA2_BCL2L11      --------------------------------------------cggggg
A0A3P8XIA2_BCL2L11      gcccaccccccaccacccctatagaccacggccaccaccaatagcggggg
A0A3P9A5G8_BAD-02       ggccggtcacagtctgctc------cccctgcgctgtgggctgcaaaaaa
A0A3P9A5G8_BAD-01       ggccggtcacagtctgctc------cccctgcgctgtgggctgcaaaaaa
A0A3P8ZIE7_BMF-01       ggcct----cagcagcgtc------cccaggcggtgagaggggggatgga

A0A3P8Y761_BAD-01       atat-------------------ggacggcagctg-------cgacgcat
A0A3P8XIA2_BCL2L11      acatgcggccggaaatactgatcggtcaggagctt-------cagcgcat
A0A3P8XIA2_BCL2L11      acatgcggccggaaatactgatcggtcaggagctt-------cagcgcat
A0A3P9A5G8_BAD-02       atat-------------------ggctgccagctg-------aggaggat
A0A3P9A5G8_BAD-01       atat-------------------ggctgccagctg-------aggaggat
A0A3P8ZIE7_BMF-01       gcac-------------------ccccaacagctgccccagcagccagta
                          *                           ****                

A0A3P8Y761_BAD-01       gagtgacgagttcgat-acgtggctggataaagggcaaatgaagcgggtg
A0A3P8XIA2_BCL2L11      tggagatgagtttaacaacctgttcatacatggggtgagtg---------
A0A3P8XIA2_BCL2L11      tggagatgagtttaacaacctgttcatacat-gggcgtctt---------
A0A3P9A5G8_BAD-02       gagtgatgaatttgac-acctggcttgacaaaggggagccca-------a
A0A3P9A5G8_BAD-01       gagtgatgaatttgac-acctggcttgacaaaggggagccca-------a
A0A3P8ZIE7_BMF-01       gcccgttgcattggac-agaagctccaactcattggtgaccagtttcatg
                            *  *  **  *  *   *     *      *               

A0A3P8Y761_BAD-01       aaga------------gtgcaggagcagccaaacagatgacaacatcccc
A0A3P8XIA2_BCL2L11      ---------------------gttgcagtaaa------------atgcct
A0A3P8XIA2_BCL2L11      ---------------------ggggcaa-gaa------------atggtc
A0A3P9A5G8_BAD-02       gaga------ggaattatcccaggaagagcaaagcag--------gtcta
A0A3P9A5G8_BAD-01       gaga------ggaattatcccaggaagagcaaagcag--------gtcta
A0A3P8ZIE7_BMF-01       aagaacatctgcaactgtatcacagaaaccaaaggaacctgaggcccctg

A0A3P8Y761_BAD-01       gagctg-----g----tgggccttcctgttcagcca---caagga-----
A0A3P8XIA2_BCL2L11      gtgttgcat---------caccttatttacaaaccatatcaaggaccg--
A0A3P8XIA2_BCL2L11      aggttgcccaag----caaaccttcctcagatgc---accaagaacctgc
A0A3P9A5G8_BAD-02       cagagga---------tggttctcgttcctctggagtccaaagga-----
A0A3P9A5G8_BAD-01       cagagga---------tggttctcgttcctctggagtccaaagga-----
A0A3P8ZIE7_BMF-01       tggtggcgcctggcctcggctctgctcactctgctgt-----ggg-----
                          *  *               **                   *       

A0A3P8Y761_BAD-01       -----aactgagacagaaaagacccccaaccttatcattactgaaccaag
A0A3P8XIA2_BCL2L11      -----cactg----------------------------tatta-----aa
A0A3P8XIA2_BCL2L11      ctttctactgtg---gatgggcctcctgattggtcgactattacagatca
A0A3P9A5G8_BAD-02       -----agctgaa--------------------ggcagggactga------
A0A3P9A5G8_BAD-01       -----agctgaa--------------------ggcagggactga------
A0A3P8ZIE7_BMF-01       -----agcagga--------------------ggccgtggctggaggcgg
                               * *                               *        

A0A3P8Y761_BAD-01       atcttctgagtag------
A0A3P8XIA2_BCL2L11      ttgagctga----------
A0A3P8XIA2_BCL2L11      tttggcggagaagataa--
A0A3P9A5G8_BAD-02       -------------------
A0A3P9A5G8_BAD-01       -------------------
A0A3P8ZIE7_BMF-01       gagagccgggtggaggtga

© 1998-2020Legal notice