Dataset for CDS BAD of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4SET9_BAD-01      ---------------------------atggcaaagatgttcagtctttc
A0A8C4SET9_BAD-02      atgtcttctattttaacagatgcagtgatggcaaagatgttcagtctttc
                                                  ***********************

A0A8C4SET9_BAD-01      agattctgaatcagatatttctgatgatgtcattcaagatggtgactcaa
A0A8C4SET9_BAD-02      agattctgaatcagatatttctgatgatgtcattcaagatggtgactcaa
                       **************************************************

A0A8C4SET9_BAD-01      gtggaagagaagtaagaaatgcaagttcagtgaaacaaagcagaacaatg
A0A8C4SET9_BAD-02      gtggaagagaagtaagaaatgcaagttcagtgaaacaaagcagaacaatg
                       **************************************************

A0A8C4SET9_BAD-01      ccttcaatcaagatgtcggatgtggaagggcgaattaggggggtttcaga
A0A8C4SET9_BAD-02      ccttcaatcaagatgtcggatgtggaagggcgaattaggggggtttcaga
                       **************************************************

A0A8C4SET9_BAD-01      atcccaggcatcagaggcagagatggatgatgaattaacctctttccgaa
A0A8C4SET9_BAD-02      atcccaggcatcagaggcagagatggatgatgaattaacctctttccgaa
                       **************************************************

A0A8C4SET9_BAD-01      atcggtcacattcagcacctccagcattgtgggcagctcgtcggtatgga
A0A8C4SET9_BAD-02      atcggtcacattcagcacctccagcattgtgggcagctcgtcggtatgga
                       **************************************************

A0A8C4SET9_BAD-01      cgtgaattgcgcagaatgagcgatgaatttggaatttctcatggggaatt
A0A8C4SET9_BAD-02      cgtgaattgcgcagaatgagcgatgaatttggaatttctcatggggaatt
                       **************************************************

A0A8C4SET9_BAD-01      taaaagggcaaagagtgctggaactgctaagcaaatgactacctcaacaa
A0A8C4SET9_BAD-02      taaaagggcaaagagtgctggaactgctaagcaaatgactacctcaacaa
                       **************************************************

A0A8C4SET9_BAD-01      gctggtggacttttttgtggagtaagagacaacagtctgaatcttccaag
A0A8C4SET9_BAD-02      gctggtggacttttttgtggagtaagagacaacagtctgaatcttccaag
                       **************************************************

A0A8C4SET9_BAD-01      gctaattaa
A0A8C4SET9_BAD-02      gctaattaa
                       *********

© 1998-2022Legal notice