Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A3Q2GRS5_BCL2L11      atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cggagccctcggctgccctgcggagcgcggcggcggcgggcgggcggcaa
A0A3Q2GRS5_BCL2L11      cggagccctcggctgccctgcggagcgcggcggcggcgggcgggcggcaa
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctt
A0A3Q2GRS5_BCL2L11      gcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctt
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgtctcccccgctgcctaagtggcgacaatcagggggctccgggtcggcg
A0A3Q2GRS5_BCL2L11      tgtctcccccgctgcctaagtggcgacaatcagggggctccgggtcggcg
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      aaaggcgcgggctggacgccgcggggcccgggcccggacgcgacgctcgg
A0A3Q2GRS5_BCL2L11      aaaggcgcgggctggacgccgcggggcccgggcccggacgcgacgctcgg
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       -----------------------------atgagaaagcggcggcgtcac
A0A3Q2HR24_BMF-02       -----------------------------atggagccgcctcagtgtgta
A0A3Q2HR24_BMF-01       -----------------------------atggagccgcctcagtgtgta
A0A3Q2I0H2_PMAIP1-      -----------------------------atg------------------
A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      -----------------------------atggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      aagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgat
A0A3Q2GRS5_BCL2L11      aagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgat
F7DN67_BAD-01           -----------------------------atgttccag----atcccaga
A0A3Q2IBL3_HRK-01       -----------------------------atg------------------
A0A3Q2GWE8_BBC3-01      -----------------------------gtg---------------aga
A0A3Q2GWE8_BBC3-02      -----------------------------gtg---------------aga
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       gcagctgctaagcgg---------cagacctgggattcgaactcaggccc
A0A3Q2HR24_BMF-02       gaggagctggaggatgatgtgttccagccagaggatggggagccggggac
A0A3Q2HR24_BMF-01       gaggagctggaggatgatgtgttccagccagaggatggggagccggggac
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgt-----------gacagagaa---------------
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgt-----------gacagagaa---------------
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgt-----------gacagagaa---------------
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgt-----------gacagagaa---------------
A0A3Q2GRS5_BCL2L11      gtaagttctgagtgt-----------gacagagaa---------------
F7DN67_BAD-01           gtttgagcagagtga-----------gccagaaga---------------
A0A3Q2IBL3_HRK-01       --------------t-----------gcccgtgc----------------
A0A3Q2GWE8_BBC3-01      gtcagcgcaggggct-----------gcccgggca---------------
A0A3Q2GWE8_BBC3-02      gtcagcgcaggggct-----------gcccgggca---------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       tctggtttcagagccgcgttcttcatcatcgtattctgtacctaaggctg
A0A3Q2HR24_BMF-02       ccagcccaggagcttgctctct----------------------------
A0A3Q2HR24_BMF-01       ccagcccaggagcttgctctct----------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------g----------------------------
A0A3Q2GRS5_BCL2L11      ---------------------g----------------------------
A0A3Q2GRS5_BCL2L11      ---------------------g----------------------------
A0A3Q2GRS5_BCL2L11      ---------------------g----------------------------
A0A3Q2GRS5_BCL2L11      ---------------------g----------------------------
F7DN67_BAD-01           ---------------------c----------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      ---------------------t----------------------------
A0A3Q2GWE8_BBC3-02      ---------------------t----------------------------
                                                                          

A0A3Q2LHE3_BIK-01       -----------------------atgtctcaagtaggacccgtctcca--
A0A3Q2LHE3_BIK-02       tttggtccagtgtgggagaagaaatgtctcaagtaggacccgtctcca--
A0A3Q2HR24_BMF-02       -----gctgacctgtttgccccgagccagctggactgccccctcagccat
A0A3Q2HR24_BMF-01       -----gctgacctgtttgccccgagccagctggactgccccctcagccat
A0A3Q2I0H2_PMAIP1-      -------------------------cctacaaggaaggcgcgtaagtc--
A0A3Q2GRS5_BCL2L11      -----gcggac------aattgcagcctgcggagaggcctcctcagct--
A0A3Q2GRS5_BCL2L11      -----gcggac------aattgcagcctgcggagaggcctcctcagct--
A0A3Q2GRS5_BCL2L11      -----gcggac------aattgcagcctgcggagaggcctcctcagct--
A0A3Q2GRS5_BCL2L11      -----gcggac------aattgcagcctgcggagaggcctcctcagct--
A0A3Q2GRS5_BCL2L11      -----gcggac------aattgcagcctgcggagaggcctcctcagct--
F7DN67_BAD-01           -----tccagccctgcagataggggcct--ggg----ccccagcccta--
A0A3Q2IBL3_HRK-01       -------------------------------------cccctgcaccg--
A0A3Q2GWE8_BBC3-01      -----gtctgt------gccaggcgcct--ggggcttccttctcaccc--
A0A3Q2GWE8_BBC3-02      -----gtctgt------gccaggcgcct--ggggcttccttctcaccc--
                                                              *           

A0A3Q2LHE3_BIK-01       ---gggacctcttt------------------------------------
A0A3Q2LHE3_BIK-02       ---gggacctcttt------------------------------------
A0A3Q2HR24_BMF-02       ctgcggctcttccctctcacccactg------------------------
A0A3Q2HR24_BMF-01       ctgcggctcttccctctcacccactg------------------------
A0A3Q2I0H2_PMAIP1-      ---tgggcagc---------------------------------------
A0A3Q2GRS5_BCL2L11      ---caggc------------------------------------------
A0A3Q2GRS5_BCL2L11      ---caggc------------------------------------------
A0A3Q2GRS5_BCL2L11      ---caggc------------------------------------------
A0A3Q2GRS5_BCL2L11      ---caggc------------------------------------------
A0A3Q2GRS5_BCL2L11      ---caggc------------------------------------------
F7DN67_BAD-01           ---cgggggac---------------------------------------
A0A3Q2IBL3_HRK-01       ---cgg--------------------------------------------
A0A3Q2GWE8_BBC3-01      ---tgggtcccccagcagactcgtggccccagggagcgccatggcccgag
A0A3Q2GWE8_BBC3-02      ---tgggtcccccagcagactcgt--------------------------
                             *                                            

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      cacgccaggagggcagctccccggagccggtagagggcctggcccgcgac
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      ggcccgcgccccttcccgctcagccgcctggtgccctcggccgtgtcctg
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      cggcctctgcgagcccggcctgcccgccgcgcccgccgcgcccgccctgc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      tgcccgctgcctacctctgcgcccccgccgccccgcccgccgtcaccgcc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      gccctggggggcccccgctggcctgggggcccccgcagccgtccccgagc
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       ----------------ctggacgccttcc------tgcacgagcgcagc-
A0A3Q2LHE3_BIK-02       ----------------ctggacgccttcc------tgcacgagcgcagc-
A0A3Q2HR24_BMF-02       ----------------ctgtggccctggccttcgacccaccagccaggaa
A0A3Q2HR24_BMF-01       ----------------ctgtggccctggccttcgacccaccagccaggaa
A0A3Q2I0H2_PMAIP1-      -------------------cgagccccacgcg---agccccggcagagc-
A0A3Q2GRS5_BCL2L11      ----------------ctggggcccccacctc---tctacagatagagca
A0A3Q2GRS5_BCL2L11      ----------------ctggggcccccacctc---tctacagatagagca
A0A3Q2GRS5_BCL2L11      ----------------ctggggcccccacctc---tctacagatagagca
A0A3Q2GRS5_BCL2L11      ----------------ctggggcccccacctc---tctacagatagagca
A0A3Q2GRS5_BCL2L11      ----------------ctggggcccccacctc---tctacagatagagca
F7DN67_BAD-01           -------------------tggccctcag--a---c---ccggtcaggca
A0A3Q2IBL3_HRK-01       ----------------ccgcggcccc-------------ccggccgtgt-
A0A3Q2GWE8_BBC3-01      cccgcgccccgacggtccacagccctcac--t---cttgccggccgagca
A0A3Q2GWE8_BBC3-02      -------------ggtccacagccctcac--t---cttgccggccgagca
                                               **              *       *  

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       g-------------------------------------------------
A0A3Q2HR24_BMF-01       g-------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      gca-----------------------------------------------
A0A3Q2GRS5_BCL2L11      gca-----------------------------------------------
A0A3Q2GRS5_BCL2L11      gcaaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctc
A0A3Q2GRS5_BCL2L11      gca-----------------------------------------------
A0A3Q2GRS5_BCL2L11      gcaaggtaatcccggaggcgaaggggaccgctgcccccaaggcagccctc
F7DN67_BAD-01           cca-----------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      gca-----------------------------------------------
A0A3Q2GWE8_BBC3-02      gca-----------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       --------------------------------------------------
A0A3Q2LHE3_BIK-02       --------------------------------------------------
A0A3Q2HR24_BMF-02       --------------------------------------------------
A0A3Q2HR24_BMF-01       --------------------------------------------------
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ccgtttttcatctttgtgagaagatcttccctgctgtctcgctcctccag
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ccgtttttcatctttgtgagaagatcttccctgctgtctcgctcctccag
F7DN67_BAD-01           --------------------------------------------------
A0A3Q2IBL3_HRK-01       -------------------------------------------------g
A0A3Q2GWE8_BBC3-01      ------------------------------------cctggagtcgccgg
A0A3Q2GWE8_BBC3-02      ------------------------------------cctggagtcgccgg
                                                                          

A0A3Q2LHE3_BIK-01       -----------ccggaagccctgg-aggttcctggcatgaccgagctcac
A0A3Q2LHE3_BIK-02       -----------ccggaagccctgg-aggttcctggcatgaccgagctcac
A0A3Q2HR24_BMF-02       -acaaggccacccagaccctcagtccagcctccccaagccagggtgtcat
A0A3Q2HR24_BMF-01       -acaaggccacccagaccctcagtccagcctccccaagccagggtgtcat
A0A3Q2I0H2_PMAIP1-      -------------------ttgaggctgagtgtgccattc----------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ---------------------agacaggagcccggcacccatgagttgtg
A0A3Q2GRS5_BCL2L11      tgggtatttctcttttgacacagacaggagcccggcacccatgagttgtg
A0A3Q2GRS5_BCL2L11      ---------------------agacaggagcccggcacccatgagttgtg
A0A3Q2GRS5_BCL2L11      tgggtatttctcttttgacacagacaggagcccggcacccatgagttgtg
F7DN67_BAD-01           -gcggacagccccaggcctcctgggggaagctggtcaccagcaggggcag
A0A3Q2IBL3_HRK-01       tgcctgcagcgcgggccgcctgggtctgcgctcgtcagc--------cgc
A0A3Q2GWE8_BBC3-01      tgcccagcgccccgggggccctggagggcggcc-ccacc--------cag
A0A3Q2GWE8_BBC3-02      tgcccagcgccccgggggccctggagggcggcc-ccacc--------cag
                                                                          

A0A3Q2LHE3_BIK-01       agagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctgg
A0A3Q2LHE3_BIK-02       agagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctgg
A0A3Q2HR24_BMF-02       gctgccttgtggggtgaccgagg------------aaccccagcgactct
A0A3Q2HR24_BMF-01       gctgccttgtggggtgaccgagg------------aaccccagcgactct
A0A3Q2I0H2_PMAIP1-      -----------------------------------aaattaggagaatt-
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      acaaatcaacacaa---------------------acgccaagtcctcc-
A0A3Q2GRS5_BCL2L11      acaaatcaacacaa---------------------acgccaagtcctcc-
A0A3Q2GRS5_BCL2L11      acaaatcaacacaa---------------------acgccaagtcctcc-
A0A3Q2GRS5_BCL2L11      acaaatcaacacaa---------------------acgccaagtcctcc-
F7DN67_BAD-01           ccggccagcagcagccaccatggag----------gcgctggggcggtg-
A0A3Q2IBL3_HRK-01       gcagctcacggccgccc------------------ggctcaaggcgctc-
A0A3Q2GWE8_BBC3-01      gcagccc-cgggagtccggggggaggaggagcagtgggcccgggagatc-
A0A3Q2GWE8_BBC3-02      gcagccc-cgggagtccggggggaggaggagcagtgggcccgggagatc-
                                                                          

A0A3Q2LHE3_BIK-01       ccttcatcggggacgagatggaagtgagatggatgctgccccacatcgct
A0A3Q2LHE3_BIK-02       ccttcatcggggacgagatggaagtgagatggatgctgccccacatcgct
A0A3Q2HR24_BMF-02       tttatggcaatgctggctaccggctccctctccctgccagtttccctgca
A0A3Q2HR24_BMF-01       tttatggcaatgctggctaccggctccctctccctgccagtttccctgca
A0A3Q2I0H2_PMAIP1-      --------------ggagacaaactgaatt--------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------ttgccaagccttcaac--------cactatctcagt
A0A3Q2GRS5_BCL2L11      --------------ttgccaagccttcaac--------cactatctcagt
A0A3Q2GRS5_BCL2L11      --------------ttgccaagccttcaac--------cactatctcagt
A0A3Q2GRS5_BCL2L11      --------------ttgccaagccttcaac--------cactatctcagt
F7DN67_BAD-01           --------------gagacccggagtcgcc--atagctcgtaccccgagg
A0A3Q2IBL3_HRK-01       --------------ggcgacgagctgcacc----agcgcaccatgtggcg
A0A3Q2GWE8_BBC3-01      --------------ggggcccagctgcggcggatggcggacgacctgaac
A0A3Q2GWE8_BBC3-02      --------------ggggcccagctgcggcggatggcggacgacctgaac
                                                                          

A0A3Q2LHE3_BIK-01       gagctg-cctggggtggccgtgtacagcttggccttcacctacaaccaga
A0A3Q2LHE3_BIK-02       gagctg-cctggggtggccgtgtacagcttggccttcacctacaaccaga
A0A3Q2HR24_BMF-02       ggcttg--------------------------------ccccttggtgag
A0A3Q2HR24_BMF-01       ggcttg--------------------------------ccccttggtgag
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -----a--------------------------------gcttccatgagg
A0A3Q2GRS5_BCL2L11      gcaatg--------------------------------gtt---------
A0A3Q2GRS5_BCL2L11      gcaatg--------------------------------gcttccatgagg
A0A3Q2GRS5_BCL2L11      gcaatg--------------------------------gcttccatgagg
A0A3Q2GRS5_BCL2L11      gcaatg--------------------------------gcttccatgagg
F7DN67_BAD-01           ggaccgaggatgaagggatggaaggggaggagcccggccccttccggggc
A0A3Q2IBL3_HRK-01       gcgccg------------cgc-----gcggagccgga--------gg---
A0A3Q2GWE8_BBC3-01      gcgctg------------tacgagcggcggagacaag--------aggag
A0A3Q2GWE8_BBC3-02      gcgctg------------tacgagcggcggagacaag--------aggag
                                                                          

A0A3Q2LHE3_BIK-01       caggcctgaggggtgtttttagaagtttcatggatggtctcactaacctc
A0A3Q2LHE3_BIK-02       caggcctgaggggtgtttttagaagtttcatggatggtctcactaacctc
A0A3Q2HR24_BMF-02       cagccccctgaagggcagtggcaacatcga-------------------g
A0A3Q2HR24_BMF-01       cagccccctgaagggcagtggcaacatcga-------------------g
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cagtcgcaggcggtccctgcagacatgcgc-------------------c
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      cagtcgcaggcggtccctgcagacatgcgc-------------------c
A0A3Q2GRS5_BCL2L11      cagtcgcaggcggtccctgcagacatgcgc-------------------c
A0A3Q2GRS5_BCL2L11      cagtcgcaggcggtccctgcagacatgcgc-------------------c
F7DN67_BAD-01           cgctcgcgctcggcgccccccaacctctgg-------------------g
A0A3Q2IBL3_HRK-01       -----gcgc-cggcgcccggc-----------------------------
A0A3Q2GWE8_BBC3-01      cagcagcga-caccgcccctc-----------------------------
A0A3Q2GWE8_BBC3-02      cagcagcga-caccgcccctc-----------------------------
                                                                          

A0A3Q2LHE3_BIK-01       agggagaacataaggttctggagcttcctgacccgcagggacagggtaag
A0A3Q2LHE3_BIK-02       agggagaacataaggttctggagcttcctgacccgcagggacagggtaag
A0A3Q2HR24_BMF-02       cagaggtacagattgcccgaaaac-ttcagtgcattgcagaccagttc--
A0A3Q2HR24_BMF-01       cagaggtacagattgcccgaaaac-ttcagtgcattgcagaccagttc--
A0A3Q2I0H2_PMAIP1-      ------------tccggcagaaac-ttctgaatctcatagccaaactc--
A0A3Q2GRS5_BCL2L11      cggaggtatggatcgctcaagagc-tgcggagaattggagacgaatttaa
A0A3Q2GRS5_BCL2L11      -------------------agagc-aatagagga----------------
A0A3Q2GRS5_BCL2L11      cggaggtatggatcgctcaagagc-tgcggagaattggagacgaatttaa
A0A3Q2GRS5_BCL2L11      cggaggtatggatcgctcaagagc-tgcggagaattggagacgaatttaa
A0A3Q2GRS5_BCL2L11      cggaggtatggatcgctcaagagc-tgcggagaattggagacgaatttaa
F7DN67_BAD-01           ctgcacgacgctacggccgcgagc-tccggaggatgagcgacgagttc--
A0A3Q2IBL3_HRK-01       ----------------------gc-gct----------------------
A0A3Q2GWE8_BBC3-01      ----------------------gc-cctggagggtcctgtacaatctcat
A0A3Q2GWE8_BBC3-02      ----------------------gc-cctggagggtcctgtacaatctcat
                                               *                          

A0A3Q2LHE3_BIK-01       cctgagatttcatgaccttgactcac---cttcctgcatgtgtagccctc
A0A3Q2LHE3_BIK-02       cctgagatttcatgaccttgactcac---cttcctgcatgtgtagccctc
A0A3Q2HR24_BMF-02       catcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggtg
A0A3Q2HR24_BMF-01       catcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtggtg
A0A3Q2I0H2_PMAIP1-      -----------------------ttc-------------------cgctc
A0A3Q2GRS5_BCL2L11      tgcc-------------------tct-------------------taccc
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      tgcc-------------------tct-------------------taccc
A0A3Q2GRS5_BCL2L11      tgcc-------------------tct-------------------taccc
A0A3Q2GRS5_BCL2L11      tgcc-------------------tct-------------------taccc
F7DN67_BAD-01           --caggtctccttccaggcacttcct-------------------cgccc
A0A3Q2IBL3_HRK-01       -----------------------ccc-------------------cacct
A0A3Q2GWE8_BBC3-01      catgggactcctgc---------ccc-------------------taccc
A0A3Q2GWE8_BBC3-02      catgggactcctgc---------ccc-------------------taccc
                                                                          

A0A3Q2LHE3_BIK-01       tggagccgtggagcagctgccccgtagggcacagcctcgc----------
A0A3Q2LHE3_BIK-02       tggagccgtggagcagctgccccgtagggcacagcctcgc----------
A0A3Q2HR24_BMF-02       gcagaccctgc----------tctttctccacaacctcgctttgaacgga
A0A3Q2HR24_BMF-01       gcagaccctgc----------tctttctccacaacctcgctttgaacgga
A0A3Q2I0H2_PMAIP1-      aggaacc-------------------------------------------
A0A3Q2GRS5_BCL2L11      acggaggctgg----------caca-------------------------
A0A3Q2GRS5_BCL2L11      ------ggttg----------tcgt-------------------------
A0A3Q2GRS5_BCL2L11      acggaggtt-----------------------------------------
A0A3Q2GRS5_BCL2L11      acggagggtcg----------ttttgaatcatcaccaagc----------
A0A3Q2GRS5_BCL2L11      acggagggtcg----------ttttgaatcatcaccaagc----------
F7DN67_BAD-01           gaagagcgcgg-----------------gcacagcgacgc----------
A0A3Q2IBL3_HRK-01       actggccctgg----------ctgt---gcgcggccgcgc----------
A0A3Q2GWE8_BBC3-01      aggggcc---------------------gagcggccccgg----------
A0A3Q2GWE8_BBC3-02      aggggcc---------------------gagcggccccgg----------
                                                                          

A0A3Q2LHE3_BIK-01       ----------tggttgccacagtccccac---------------------
A0A3Q2LHE3_BIK-02       ----------tggttgccacagtccccac---------------------
A0A3Q2HR24_BMF-02       gacgagaacaggaacggggcaggtcccag-gtgtggtaaaaatgtgaggg
A0A3Q2HR24_BMF-01       gacgagaacaggaacggggcaggtcccagcttccagccaggccaggaggg
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ----------agctgaagcccacccccaa---------------------
A0A3Q2GRS5_BCL2L11      ----------agctgaagcccacccccaa---------------------
F7DN67_BAD-01           ----------agatgcggcaaagccccag---------------------
A0A3Q2IBL3_HRK-01       ----------aggtggcg------gc--g---------------------
A0A3Q2GWE8_BBC3-01      ----------agatggag------cccaa---------------------
A0A3Q2GWE8_BBC3-02      ----------agatggag------cccaa---------------------
                                                                          

A0A3Q2LHE3_BIK-01       -------------------------caatccctattgtcttcttttgcct
A0A3Q2LHE3_BIK-02       -------------------------caatccctattgtcttcttttgcct
A0A3Q2HR24_BMF-02       gacccgttagggaattggagacttctgacttgtttctcagctgccatcct
A0A3Q2HR24_BMF-01       tgtgctctggaagtcagcaggattgcagct---------gcctctgtccg
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -----------------atgcctggcattctacacc--------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      ------atgatcatcttgcgactgttacgttacatcatccgcctggtacg
A0A3Q2GRS5_BCL2L11      ------atgatcatcttgcgactgttacgttacatcatccgcctggtacg
F7DN67_BAD-01           ------ctggacgcgcgccatccagtcctggtgggatcggaacttgggga
A0A3Q2IBL3_HRK-01       ------ctggcggcct----------------------ggctgctcggca
A0A3Q2GWE8_BBC3-01      ------ctaggtgcctgca--cccgcccgggggacgtcggggacttgggg
A0A3Q2GWE8_BBC3-02      ------ctag----------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       gcttcacccattcctcctcctgcctgttccctgggcctttgggtttgaga
A0A3Q2LHE3_BIK-02       gcttcacccattcctcctcctgcctgttccctgggcctttgggtttgaga
A0A3Q2HR24_BMF-02       gagtta--cccccagctcccggcttttgtc---------aggacttcgtg
A0A3Q2HR24_BMF-01       aacttcttcccttctctccctgctgtggcactaatggagagaatttaaag
A0A3Q2I0H2_PMAIP1-      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      --------------------------------------------------
A0A3Q2GRS5_BCL2L11      -aga--gc------------------------------------------
A0A3Q2GRS5_BCL2L11      gagactgc------------------------------------------
A0A3Q2GRS5_BCL2L11      gagactgc------------------------------------------
F7DN67_BAD-01           gaggaggctccgccccctccc-----------------------------
A0A3Q2IBL3_HRK-01       ggcggaact-----------------------------------------
A0A3Q2GWE8_BBC3-01      ggcaggaccctcccacctcctgacgccctggccagcgcggggggctctt-
A0A3Q2GWE8_BBC3-02      --------------------------------------------------
                                                                          

A0A3Q2LHE3_BIK-01       tggctggctt------actga
A0A3Q2LHE3_BIK-02       tggctggctt------actga
A0A3Q2HR24_BMF-02       c------tctcttggagttga
A0A3Q2HR24_BMF-01       cagccagtctggctgctctga
A0A3Q2I0H2_PMAIP1-      ------------------tga
A0A3Q2GRS5_BCL2L11      ------------------tga
A0A3Q2GRS5_BCL2L11      -----------------gtag
A0A3Q2GRS5_BCL2L11      ----------------aatag
A0A3Q2GRS5_BCL2L11      ----------------agtga
A0A3Q2GRS5_BCL2L11      ----------------agtga
F7DN67_BAD-01           ----------------agtga
A0A3Q2IBL3_HRK-01       ----------------tgtag
A0A3Q2GWE8_BBC3-01      -------tctgcaccatgtag
A0A3Q2GWE8_BBC3-02      ---------------------
                                             

© 1998-2020Legal notice