Dataset for CDS BBC3 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F5PGZ4_BBC3-01      gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctgg
A0A5F5PGZ4_BBC3-02      gtgagagtcagcgcaggggctgcccgggcatgtctgtgccaggcgcctgg

A0A5F5PGZ4_BBC3-01      ggcttccttctcaccctgggtcccccagcagactcgtggccccagggagc
A0A5F5PGZ4_BBC3-02      ggcttccttctcaccctgggtcccccagcagactcgt-------------

A0A5F5PGZ4_BBC3-01      gccatggcccgagcacgccaggagggcagctccccggagccggtagaggg
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcagccgcctggtgccct
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      cggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcgcccgcc
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      gcgcccgccctgctgcccgctgcctacctctgcgcccccgccgccccgcc
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      cgccgtcaccgccgccctggggggcccccgctggcctgggggcccccgca
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      gccgtccccgagccccgcgccccgacggtccacagccctcactcttgccg
A0A5F5PGZ4_BBC3-02      --------------------------ggtccacagccctcactcttgccg

A0A5F5PGZ4_BBC3-01      gccgagcagcacctggagtcgccggtgcccagcgccccgggggccctgga
A0A5F5PGZ4_BBC3-02      gccgagcagcacctggagtcgccggtgcccagcgccccgggggccctgga

A0A5F5PGZ4_BBC3-01      gggcggccccacccaggcagccccgggagtccggggggaggaggagcagt
A0A5F5PGZ4_BBC3-02      gggcggccccacccaggcagccccgggagtccggggggaggaggagcagt

A0A5F5PGZ4_BBC3-01      gggcccgggagatcggggcccagctgcggcggatggcggacgacctgaac
A0A5F5PGZ4_BBC3-02      gggcccgggagatcggggcccagctgcggcggatggcggacgacctgaac

A0A5F5PGZ4_BBC3-01      gcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctc
A0A5F5PGZ4_BBC3-02      gcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctc

A0A5F5PGZ4_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgcccctaccca
A0A5F5PGZ4_BBC3-02      gccctggagggtcctgtacaatctcatcatgggactcctgcccctaccca

A0A5F5PGZ4_BBC3-01      ggggccgagcggccccggagatggagcccaactaggtgcctgcacccgcc
A0A5F5PGZ4_BBC3-02      ggggccgagcggccccggagatggagcccaactag---------------

A0A5F5PGZ4_BBC3-01      cgggggacgtcggggacttggggggcaggaccctcccacctcctgacgcc
A0A5F5PGZ4_BBC3-02      --------------------------------------------------

A0A5F5PGZ4_BBC3-01      ctggccagcgcggggggctctttctgcaccatgtag
A0A5F5PGZ4_BBC3-02      ------------------------------------

© 1998-2022Legal notice