Dataset for CDS BCL2L11 of organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W4H3Y1_BCL2L11      cgcatacggcaaaaccgggccaatggcccagccttcttaaaggagcaggg
A0A4W4H3Y1_BCL2L11      ---atacggcaaaaccgggccaatggcccagccttcttaaaggagcaggg

A0A4W4H3Y1_BCL2L11      ggaaagcggagaaaacaccggtgtcggaacagcctcccggcccgaacagt
A0A4W4H3Y1_BCL2L11      ggaaagcggagaaaacaccggtgtcggaacagcctcccggcccgaacagt

A0A4W4H3Y1_BCL2L11      ttgactgctctcatccgaaccaaggggaccaatttaggggagggattaca
A0A4W4H3Y1_BCL2L11      ttgactgctctcatccgaaccaaggggaccaatttaggggagggattaca

A0A4W4H3Y1_BCL2L11      agtagtctttctggttaccattcaaggtcgcctctattccgaactctctc
A0A4W4H3Y1_BCL2L11      agtagtctttctggttaccattcaaggtcgcctctattccgaactctctc

A0A4W4H3Y1_BCL2L11      cagatcctcgagtggatatttttcgttcgacagtgagccaagctctccac
A0A4W4H3Y1_BCL2L11      cagatcctcgagtggatatttttcgttcgacagtgagccaagctctccac

A0A4W4H3Y1_BCL2L11      taatgacacatagcacgtctactcaaactccgagtccatctagtcaagtg
A0A4W4H3Y1_BCL2L11      taatgacacatagcacgtctactcaaactccgagtccatctagtcaagtg

A0A4W4H3Y1_BCL2L11      ataattcacgccctgcaacgcatttccgaagcgcaaggcaacggtcaaaa
A0A4W4H3Y1_BCL2L11      ataattcacgccctgcaac-------------------------------

A0A4W4H3Y1_BCL2L11      ttatgagttatggaccggaccccctaatgaagcgttgtctgtgagggaca
A0A4W4H3Y1_BCL2L11      --------------------------------------------------

A0A4W4H3Y1_BCL2L11      tgcgagcggagttgtacgtcgcgcaggagctgcggcgcatcggtgatgac
A0A4W4H3Y1_BCL2L11      ------cggagttgtacgtcgcgcaggagctgcggcgcatcggtgatgac

A0A4W4H3Y1_BCL2L11      ttcaaccgaatttattttcggggggtggagaggaatggtggtgcagccca
A0A4W4H3Y1_BCL2L11      ttcaaccgaatttattttcggggggtg-------atgg---------ctt
                        ***************************       ****         *  

A0A4W4H3Y1_BCL2L11      acagcctgcccagaatgaacccgctttgctgcagtggattgggctcctga
A0A4W4H3Y1_BCL2L11      gctttctggcctgtacg-----tttgtggtcctgtggataaatctgtgga
                         *   *** ** * * *       * ** * * ******    **   **

A0A4W4H3Y1_BCL2L11      t------tggacgcctattacagcttctcctgagaagaagataa------
A0A4W4H3Y1_BCL2L11      taaatcctgaccctttatt-----tcctctcacacaatatttaaagcttt
                        *      **  *   ****     * ***      *  *  ***      

A0A4W4H3Y1_BCL2L11      --
A0A4W4H3Y1_BCL2L11      ag

© 1998-2021Legal notice