Dataset for CDS BAD of organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W4DXF5_BAD-01      atgcacaatcaatatttgttga--------gattgaggaaagcgaatttt
A0A4W4HE29_BAD-01      atgtttaa-cagcagct-ttgacttcgatcggttgagaaaag----tttg
                       ***   ** **  *  * ****        * ***** ****    *** 

A0A4W4DXF5_BAD-01      actcgcgaggattataaaaaagtaatca-----aggccaaaacactgcgt
A0A4W4HE29_BAD-01      tgcggcgcgtcaccgagaacaacaaccacccgcagaccaaacgagta---
                           *** *      * ** *  ** **     ** *****  * *    

A0A4W4DXF5_BAD-01      gaagagggagagacaccttc-----gaacacatcg--tgctggaatcctt
A0A4W4HE29_BAD-01      ggagcgttagcgttagctaccgggagttcacatcagccgccggtcagctg
                       * ** *  ** *  * ** *     *  ******    ** **    ** 

A0A4W4DXF5_BAD-01      ttag-agtcacagctttcacaatggaaaagg----caccatgt-ggtcaa
A0A4W4HE29_BAD-01      tcagaagtc---gttttcacaatggctcagatgttcactatatctgacac
                       * ** ****   * ***********   **     *** ** *  * ** 

A0A4W4DXF5_BAD-01      agagatg---acatcagtgcattggatgaccaagacgaatcaagatggtc
A0A4W4HE29_BAD-01      agagtcagacacatc-------tgaaggaccagga-gacacagaccagca
                       ****      *****       ** * ***** ** **  **     *  

A0A4W4DXF5_BAD-01      agagacaatcgagagtgatgactcccctcgaatcagcaatcatcacatca
A0A4W4HE29_BAD-01      aggggacagcaaggaagctg-----------------agccttcacagtc
                       ** *   * * **   * **                 *  * *****   

A0A4W4DXF5_BAD-01      tgccaaacaacacagcaacagaggtcgggggtcgtgtgcggctctactcc
A0A4W4HE29_BAD-01      tg-----------agcaaca------------------------------
                       **           *******                              

A0A4W4DXF5_BAD-01      gagtcccaggcatacacagtgagccactgggaagacactgagtcccaaga
A0A4W4HE29_BAD-01      ----cctacacgtacctaata---cactcagaggagaatggacggcgagg
                           ** *  * ***  * *    ****  ** ** * **     * ** 

A0A4W4DXF5_BAD-01      tggagt-gtcagcagaagagggtggaggagcttgtga----aggagcc--
A0A4W4HE29_BAD-01      cagaggaatcactcaatgaatgaggcggagcttcaggactcaggagctga
                         ***   ***    * **  * ** *******  *     ******   

A0A4W4DXF5_BAD-01      -ccattccgtggccgatcccagtctgctcctgctgcactatggaaagcca
A0A4W4HE29_BAD-01      gtctttccgtcgtcgttcccgttcagctcccccaattctgtgggcagcca
                         * ****** * ** ****  ** *****  *    ** ***  *****

A0A4W4DXF5_BAD-01      agaaatatggacggcaactgaggaggatgagcgatgagtttgacacctgg
A0A4W4HE29_BAD-01      agaaatatggcagacagttaaggaagatgagcgatgagtttgacacctta
                       **********  * **  * **** ***********************  

A0A4W4DXF5_BAD-01      ctggacaaaggggagataagaagagtgagcagccctgggaaactgtcaca
A0A4W4HE29_BAD-01      ctggacaaagg---gatgaagagggcaaggagcgcaggagcagctcgtca
                       ***********   *** *  ** *  ** *** * **   *      **

A0A4W4DXF5_BAD-01      gaagcagaccaaccaaggatggttctctttcctttggtgttccaaggaa-
A0A4W4HE29_BAD-01      gatgcacacatcccccagctggttcgccttcctctggagccacaaagagt
                       ** *** **   **   * ****** * ***** *** *   *** **  

A0A4W4DXF5_BAD-01      --------gaggaaggaag------------------------------a
A0A4W4HE29_BAD-01      cagacaccgagaccagcagcagcgtaacagccccagatacccgccctgca
                               ***    * **                              *

A0A4W4DXF5_BAD-01      aagtaa
A0A4W4HE29_BAD-01      gaataa
                        * ***

© 1998-2020Legal notice