Dataset for CDS classical BH3-containing proteins of organism Echeneis naucrates

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A665TUH3_BAD-01      atgagtgcacaattcaccatttcagacag----------tgagtcagatc
A0A665VG08_BMF-01      atggatga-------------tgaggaagatgatgtgtttgagccagacc
                       ***  **              * **  **          **** **** *

A0A665TUH3_BAD-01      ----cttcagaggaagtagaag-aaggagacatgagccagtcattggagc
A0A665VG08_BMF-01      cccacttctggcgcaccacattcagggagataaagtgtgaacaccggggc
                           **** *  * *  * *   * ***** *         **  ** **

A0A665TUH3_BAD-01      aggaggtttttcaacgccacaatctcaccttacctgagatccgtactgca
A0A665VG08_BMF-01      -------------acgcagacacctggccctgccctgggaccgaacaacg
                                    ****    * **  ** * **   *  *** **  * 

A0A665TUH3_BAD-01      g-gggctggcc---------------gaaccaggctgaatt-----caga
A0A665VG08_BMF-01      gcatgctgccctgtggcatcgcaaaagagccaagaccactcttctacggc
                       *   **** **               ** *** *   * *      * * 

A0A665TUH3_BAD-01      gtcccacacttccactggc---tccagagacga---ggatttcctgg---
A0A665VG08_BMF-01      aacgcaggttttcgattgcacttcccggcacaatttgagcttgctgggga
                         * **   ** *  * **   *** *  ** *   *   ** ****   

A0A665TUH3_BAD-01      ccagg------ggggatgacgaagccggtacacctactgatggagctcca
A0A665VG08_BMF-01      tcaggaagtgaggggtcaaggaagcgaaga-----------ggagc----
                        ****      ****   * *****    *           *****    

A0A665TUH3_BAD-01      ttccggggacggtccaagtcagctcctcctgc-----cctgtgg---gcg
A0A665VG08_BMF-01      -----aaaacgggatggagcagctaccccggcagcagcctgtggcacgca
                               ****       ***** * ** **     *******   ** 

A0A665TUH3_BAD-01      gccaagaaata-----tggccagaagctcaggaggatgagcgatgaattt
A0A665VG08_BMF-01      gcattgaagtctgcattggccagaaactccagctgataggagaccagttt
                       **   *** *      ********* ***  *  ***  * **  * ***

A0A665TUH3_BAD-01      gacagcctgcttgacaaaggggagatgaggaaagtgaagagcgttgggtc
A0A665VG08_BMF-01      caccg-----------------------ggaacacctacaac--tgtatc
                        ** *                       ****     * * *  **  **

A0A665TUH3_BAD-01      agccaaacagatgca--------ccactctaaaagctggtggaacta---
A0A665VG08_BMF-01      atcaaaaccaaaggaaccaggggccgctgtggtggcgactgg--ccacgg
                       * * ****  * * *        ** ** *    **   ***  * *   

A0A665TUH3_BAD-01      -cctctttagtcaccag-gagacagaaggagaaaacaaccaccttgaaag
A0A665VG08_BMF-01      ccctgctcagcctcctgtttgacagaggt-----ttaattgctgggggag
                        ***  * ** * ** *   ****** *        **   *   *  **

A0A665TUH3_BAD-01      ccaccgcaacgagtag----
A0A665VG08_BMF-01      gtggagcaggacggaggtga
                            ***    * **    

© 1998-2020Legal notice