Dataset for CDS BMF of organism Dromaius novaehollandiae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4J3Z9_BMF-02      atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-03      atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-01      atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-04      atggatcaccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A8C4J3Z9_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-03      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-04      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A8C4J3Z9_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-03      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-04      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                       **************************************************

A0A8C4J3Z9_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-03      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-04      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
                       **************************************************

A0A8C4J3Z9_BMF-02      tagcaggcatcctgagcagcaggacaaggcaactcaaacactcagccagt
A0A8C4J3Z9_BMF-03      tagcaggcatcctgagcagcaggacaaggcaactcaaacactcagccagt
A0A8C4J3Z9_BMF-01      tagcaggcatcctgagcagcaggacaaggcaactcaaacactcagccagt
A0A8C4J3Z9_BMF-04      tagcaggcatcctgagcagcaggacaaggcaactcaaacactcagccagt
                       **************************************************

A0A8C4J3Z9_BMF-02      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C4J3Z9_BMF-03      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C4J3Z9_BMF-01      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C4J3Z9_BMF-04      cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A8C4J3Z9_BMF-02      cggagactcttctatgggaatgctggttaccgtttacacgttccttcagt
A0A8C4J3Z9_BMF-03      cggagactcttctatgggaatgctggttaccgtttacacgttccttcagt
A0A8C4J3Z9_BMF-01      cggagactcttctatgggaatgctggttaccgtttacacgttccttcagt
A0A8C4J3Z9_BMF-04      cggagactcttctatgggaatgctggttaccgtttacacgttccttcagt
                       **************************************************

A0A8C4J3Z9_BMF-02      tggctttgcattggatccacatctccaagaggagccgcaggaaggtcagc
A0A8C4J3Z9_BMF-03      tggctttgcattggatccacatctccaagaggagccgcaggaaggtcagc
A0A8C4J3Z9_BMF-01      tggctttgcattggatccacatctccaagaggagccgcaggaaggtcagc
A0A8C4J3Z9_BMF-04      tggctttgcattggatccacatctccaagaggagccgcaggaaggtcagc
                       **************************************************

A0A8C4J3Z9_BMF-02      gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgca
A0A8C4J3Z9_BMF-03      gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgca
A0A8C4J3Z9_BMF-01      gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgca
A0A8C4J3Z9_BMF-04      gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgca
                       **************************************************

A0A8C4J3Z9_BMF-02      gaccagttccaccggctccacgtgcaga----------------------
A0A8C4J3Z9_BMF-03      gaccagttccaccggctccacgtgcagaggcatcagcagaacagaaatca
A0A8C4J3Z9_BMF-01      gaccagttccaccggctccacgtgcagaggcatcagcagaacagaaatca
A0A8C4J3Z9_BMF-04      gaccagttccaccggctccacgtgcagaggcatcagcagaacagaaatca
                       ****************************                      

A0A8C4J3Z9_BMF-02      -----ggggacactgtttgttcaatccaggcaactgtgtc-aaggtatgg
A0A8C4J3Z9_BMF-03      agtgtggtggcagctttttctctttctacacaacttggccttaaatgtgg
A0A8C4J3Z9_BMF-01      agtgtggtggcagctttttctctttctacacaacttggccttaaatgtgg
A0A8C4J3Z9_BMF-04      agtgtggtggcagctttttctctttctacacaacttggccttaaatgtgg
                            ** * **   ***  **  ** *  *****  * *  *  * ***

A0A8C4J3Z9_BMF-02      ggatcctcagcaggaggacagcggaacggtttgtacg--------tatgt
A0A8C4J3Z9_BMF-03      -----------aggcgaacag-gaaccacactgggcagagccacagaaag
A0A8C4J3Z9_BMF-01      -----------aggcgaacag-gaaccacactgggca-------------
A0A8C4J3Z9_BMF-04      -----------aggcgaacag-gaaccacactgggca-------------
                                  *** * **** * * *    **  *              

A0A8C4J3Z9_BMF-02      gagagcccaagcagaagctcggatgaacgc--------------------
A0A8C4J3Z9_BMF-03      gagggtctcttcctg-----------------------------------
A0A8C4J3Z9_BMF-01      gagg----------------------------------------------
A0A8C4J3Z9_BMF-04      gagggtcctttcatcaggtgcagtcatagaccagcagatcaaagctgcat
                       ***                                               

A0A8C4J3Z9_BMF-02      --tga
A0A8C4J3Z9_BMF-03      --tga
A0A8C4J3Z9_BMF-01      --tga
A0A8C4J3Z9_BMF-04      cataa
                         * *

© 1998-2022Legal notice