Dataset for CDS BMF of organism Denticeps clupeoides

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4C2E0_BMF-01      ---------------------------------------------atgga
A0A8C4C2E0_BMF-02      atggagggtgtatttatgaggcagcctgtctatgtggaccccctcatgga
                                                                    *****

A0A8C4C2E0_BMF-01      ggatgaggatgaggatgtgttcagtggacacccacacctttggcatactc
A0A8C4C2E0_BMF-02      ggatgaggatgaggatgtgttcagtggacacccacacctttggcatactc
                       **************************************************

A0A8C4C2E0_BMF-01      atttcagggagataaaatataaggacaggggcacgcagacgccgggcccg
A0A8C4C2E0_BMF-02      atttcagggagataaaatataaggacaggggcacgcagacgccgggcccg
                       **************************************************

A0A8C4C2E0_BMF-01      gctctctcattgggcaacgggatgctgccattcggcctggcagaggagcc
A0A8C4C2E0_BMF-02      gctctctcattgggcaacgggatgctgccattcggcctggcagaggagcc
                       **************************************************

A0A8C4C2E0_BMF-01      cagacgactctttcacggtaacgcagctttccgtttgcacttccctgccc
A0A8C4C2E0_BMF-02      cagacgactctttcacggtaacgcagctttccgtttgcacttccctgccc
                       **************************************************

A0A8C4C2E0_BMF-01      attttgagcgtgtgggcgaagccatgccagaagatcagcagggacaggca
A0A8C4C2E0_BMF-02      attttgagcgtgtgggcgaagccatgccagaagatcagcagggacaggca
                       **************************************************

A0A8C4C2E0_BMF-01      gatcgtcaccatcagtggccgagtgtggaggcccagattgggcagaagct
A0A8C4C2E0_BMF-02      gatcgtcaccatcagtggccgagtgtggaggcccagattgggcagaagct
                       **************************************************

A0A8C4C2E0_BMF-01      tcaaatgattggagaccagttccatcaagaacatgtacagcagcatcaca
A0A8C4C2E0_BMF-02      tcaaatgattggagaccagttccatcaagaacatgtacagcagcatcaca
                       **************************************************

A0A8C4C2E0_BMF-01      gaaaccaaaggtggcggcgacagccattcctgtggcgcttggcctttgct
A0A8C4C2E0_BMF-02      gaaaccaaaggtggcggcgacagccattcctgtggcgcttggcctttgct
                       **************************************************

A0A8C4C2E0_BMF-01      ttgtacaccttgatctttgaaagggatgctgttggcgttcaagggagagg
A0A8C4C2E0_BMF-02      ttgtacaccttgatctttgaaagggatgctgttggcgttcaagggagagg
                       **************************************************

A0A8C4C2E0_BMF-01      attggagcagagagccggaggtgtgcgcggcaggcctgttgttagcactg
A0A8C4C2E0_BMF-02      attggagcagag--------------------------------------
                       ************                                      

A0A8C4C2E0_BMF-01      tcagctatcctggattcacctgtcgaaccactttcttggcaaagactact
A0A8C4C2E0_BMF-02      --------------------------------------------------
                                                                         

A0A8C4C2E0_BMF-01      gccgcagggccaatgagcacaactgacaggagatgtgggtttcatcatat
A0A8C4C2E0_BMF-02      --------------------------------------------------
                                                                         

A0A8C4C2E0_BMF-01      aagcgcaggctctacgaataagggactgtaa
A0A8C4C2E0_BMF-02      ---------------------------gtga
                                                  ** *

© 1998-2022Legal notice