Dataset for CDS BMF of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1P2N8_BMF-03      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C1XUF5_BMF-01      atgaac-------------atatctactgta--tntctacagcgctggcc
A0A8C1P2N8_BMF-01      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C1P2N8_BMF-02      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C2DDJ7_BMF-01      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C1UAR1_BMF-01      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C1UAR1_BMF-02      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
A0A8C2DDJ7_BMF-02      atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggcc
                       *** *              ** *  ** * *    ******** ******

A0A8C1P2N8_BMF-03      ttcctcccgtgttcagttaaagcagacagagaccgcagggagagccccag
A0A8C1XUF5_BMF-01      ttcctcccacgttcagttaaagcagacagagaccgcagggagagccccag
A0A8C1P2N8_BMF-01      ttcctcccgtgttcagttaaagcagacagagaccgcagggagagccccag
A0A8C1P2N8_BMF-02      ttcctcccgtgttcagttaaagcagacagagaccgcagggagagccccag
A0A8C2DDJ7_BMF-01      ttcctcccaggttcagataaagcagaccgagaccgcagggagagcccctg
A0A8C1UAR1_BMF-01      ttcctcccaggttcagataaagcagaccgatacggcagggagagcccctg
A0A8C1UAR1_BMF-02      ttcctcccaggttcagataaagcagaccgatacggcagggagagcccctg
A0A8C2DDJ7_BMF-02      ttcctcccaggttcagataaagcagaccgagaccgcagggagagcccctg
                       ********  ****** ********** ** ** ************** *

A0A8C1P2N8_BMF-03      tatcacccagcgtaatgctgccctgccgagt---------gcccacacgc
A0A8C1XUF5_BMF-01      tatcacccagcgtaatgctgccctgccgagt---------gcccacacgc
A0A8C1P2N8_BMF-01      tatcacccagcgtaatgctgccctgccgagt---------gcccacacgc
A0A8C1P2N8_BMF-02      tatcacccagcgtaatgctgccctgccgagt---------gcccacacgc
A0A8C2DDJ7_BMF-01      tatcgcccaacagcatgctgccctgccgagtgcatgtggagcccagacgc
A0A8C1UAR1_BMF-01      tatcgcccgacagcatgctgccctgccgagtgcatgtggagcccagacgc
A0A8C1UAR1_BMF-02      tatcgcccgacagcatgctgccctgccgagtgcatgtggagcccagacgc
A0A8C2DDJ7_BMF-02      tatcgcccaacagcatgctgccctgccgagtgcatgtggagcccagacgc
                       **** ***  *   *****************         ***** ****

A0A8C1P2N8_BMF-03      cttttctacggtagcgcaggattgttactgctagcgccgccgagccgctc
A0A8C1XUF5_BMF-01      cttttctacggtaacgcaggattgttactgctggcgccgccgagccgctc
A0A8C1P2N8_BMF-01      cttttctacggtagcgcaggattgttactgctagcgccgccgagccgctc
A0A8C1P2N8_BMF-02      cttttctacggtagcgcaggattgttactgctagcgccgccgagccgctc
A0A8C2DDJ7_BMF-01      tttctctacggtaacgcaggactgctgctgctagcgtcgctcggccgctc
A0A8C1UAR1_BMF-01      tttctctacggtaacgcaggactgctgctgctagcgtcgctcggccgctc
A0A8C1UAR1_BMF-02      tttctctacggtaacgcaggactgctgctgctagcgtcgctcggccgctc
A0A8C2DDJ7_BMF-02      tttctctacggtaacgcaggactgctgctgctagcgtcgctcggccgctc
                        ** ********* ******* ** * ***** *** ***   *******

A0A8C1P2N8_BMF-03      ccagcctccagacgtggtgctccggcagaacctgcggatgatggagccgg
A0A8C1XUF5_BMF-01      ccagcctccagacgtggtgctccggcagaacctgcggatgatggagccag
A0A8C1P2N8_BMF-01      ccagcctccagacgtggtgctccggcagaacctgcggatgatggagccgg
A0A8C1P2N8_BMF-02      ccagcctccagacgtggtgctccggcagaacctgcggatgatggagccgg
A0A8C2DDJ7_BMF-01      tcggcctccacacgtggttctccggcagaacctgcgcatgatggacccgg
A0A8C1UAR1_BMF-01      tcggcctccacacgtggttctccggcagaacctgcgcatgatggacccgg
A0A8C1UAR1_BMF-02      tcggcctccacacgtggttctccggcagaacctgcgcatgatggacccgg
A0A8C2DDJ7_BMF-02      tcggcctccacacgtggttctccggcagaacctgcgcatgatggacccgg
                        * ******* ******* ***************** ******** ** *

A0A8C1P2N8_BMF-03      cggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccag
A0A8C1XUF5_BMF-01      cggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccag
A0A8C1P2N8_BMF-01      cggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccag
A0A8C1P2N8_BMF-02      cggcgcggcccgagcggagcgtggagaccctcatcgggcagaagctccag
A0A8C2DDJ7_BMF-01      agg------------agagcgtggagaccctcatcgggcagaagctccag
A0A8C1UAR1_BMF-01      agg------------agagcgtggagaccctcatcgggcagaagctccag
A0A8C1UAR1_BMF-02      agg------------agagcgtggagaccctcatcgggcagaagctccag
A0A8C2DDJ7_BMF-02      agg------------agagcgtggagaccctcatcgggcagaagctccag
                        **             **********************************

A0A8C1P2N8_BMF-03      ctgatcggagatcagttctatcaggagcacatgatg------------ca
A0A8C1XUF5_BMF-01      ctgatcggagatcagttctatcaggagcacatgatg------------ca
A0A8C1P2N8_BMF-01      ctgatcggagatcagttctatcaggagcacatgatg-------------g
A0A8C1P2N8_BMF-02      ctgatcggagatcagttctatcaggagcacatgatg-------------a
A0A8C2DDJ7_BMF-01      ctgatcggagatcagttctatcaggagcacatgatgaaacaggcttgctc
A0A8C1UAR1_BMF-01      ctgatcggagatcagttctatcaggagcacatgatgagc--------tcc
A0A8C1UAR1_BMF-02      ctgatcggagatcagttctatcaggagcacatgatg------------ca
A0A8C2DDJ7_BMF-02      ctgatcggagatcagttctatcaggagcacatgatg------------ca
                       ************************************              

A0A8C1P2N8_BMF-03      tcacagaa--accaaaggatccgggagcc--gctgtggtggc--------
A0A8C1XUF5_BMF-01      tcacagaa--accaaaggatccgggagcc--gctgtggtggc--------
A0A8C1P2N8_BMF-01      acacacag--tggaaaaagagctggagcc--ttggagctgca--------
A0A8C1P2N8_BMF-02      gctcc-----tcaaacaatcgcctgagc-------ggctgca--------
A0A8C2DDJ7_BMF-01      tcagatca----------gatgtagagtttgtctgagctg--------ca
A0A8C1UAR1_BMF-01      tcaaacaatcgcctgagcgact-gcagccaagccctgatggccataaaca
A0A8C1UAR1_BMF-02      tcacagaa--accaaaggaaccgggagcc--gctgtggtggc--------
A0A8C2DDJ7_BMF-02      tcacagaa--accaaaggaaccgggagcc--gctgtggtggc--------
                        *                       **         * **          

A0A8C1P2N8_BMF-03      ---gtgtggcgctggcgg----------tctacacgc-tggtattcggca
A0A8C1XUF5_BMF-01      ---gtgtggcgctggcgg----------tctacacgc-tggtattcggca
A0A8C1P2N8_BMF-01      ---gtgattcatggacgggacgggaacgtctgcatgattaaaacacggca
A0A8C1P2N8_BMF-02      ---gccaagccctgatgg-------------ccataa----------aca
A0A8C2DDJ7_BMF-01      gaagtgtgtggatggtgg--------------cgtgt-ctcggtgctggc
A0A8C1UAR1_BMF-01      agattgtggagccgttcg----------tctccacct-cct---------
A0A8C1UAR1_BMF-02      ---gcgtggcgctggcgg----------tctacacgc-ttttatttggaa
A0A8C2DDJ7_BMF-02      ---gcgtggcgctggcgg----------tctacacgc-ttttatttggaa
                                    *   *              *                 

A0A8C1P2N8_BMF-03      gagaggccgag---------gcgagggagaatc---------gcaggt--
A0A8C1XUF5_BMF-01      gagaggccgag---------gcgagggagaatc---------gcaggt--
A0A8C1P2N8_BMF-01      aaatattggtgccacaccaagcatgcgatttat---------gaaggt-c
A0A8C1P2N8_BMF-02      agattgtggagccattc---gtctccacctcct---------gcaggtcc
A0A8C2DDJ7_BMF-01      aggagctgcag---------tcaa--accaatctctccagcagtaatt--
A0A8C1UAR1_BMF-01      --------------------------gcagatc-------------ct--
A0A8C1UAR1_BMF-02      gagaggccgag---------gcgagagcgaatc---------gcaggt--
A0A8C2DDJ7_BMF-02      gagaggccgag---------gcgagagcgaatc---------gcaggt--
                                                                      *  

A0A8C1P2N8_BMF-03      -ga
A0A8C1XUF5_BMF-01      -ga
A0A8C1P2N8_BMF-01      taa
A0A8C1P2N8_BMF-02      tga
A0A8C2DDJ7_BMF-01      -ag
A0A8C1UAR1_BMF-01      -ga
A0A8C1UAR1_BMF-02      -ga
A0A8C2DDJ7_BMF-02      -ga
                          

© 1998-2022Legal notice