Dataset for CDS BMF of organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2CXC4_BMF-01      atggaggaggaggaggatgatgtgtttgagccagatcccaacagctggca
A0A3Q2CXC4_BMF-02      atggaggaggaggaggatgatgtgtttgagccagatcccaacagctggca
                       **************************************************

A0A3Q2CXC4_BMF-01      cacaccattcagggagataaagtttgaagaccggggcacacaaacgcccg
A0A3Q2CXC4_BMF-02      cacaccattcagggagataaagtttgaagaccggggcacacaaacgcccg
                       **************************************************

A0A3Q2CXC4_BMF-01      gtcctggcgtggcaccacataacgttatgctgccctgtggagttgtggag
A0A3Q2CXC4_BMF-02      gtcctggcgtggcaccacataacgttatgctgccctgtggagttgtggag
                       **************************************************

A0A3Q2CXC4_BMF-01      gagcccagaccacttttctaccgtaacgcaggttttcgattgcacttccc
A0A3Q2CXC4_BMF-02      gagcccagaccacttttctaccgtaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3Q2CXC4_BMF-01      agcacattttgagcttgtcggggattttgacgtaaggcgacaagcggagc
A0A3Q2CXC4_BMF-02      agcacattttgagcttgtcggggattttgacgtaaggcgacaagcggagc
                       **************************************************

A0A3Q2CXC4_BMF-01      acaacaggatggagcagttacctttgcaacagccggcagcactcagcttg
A0A3Q2CXC4_BMF-02      acaacaggatggagcagttacctttgcaacagccggcagcactcagcttg
                       **************************************************

A0A3Q2CXC4_BMF-01      gaggcctgcatcgggcagaaacttcagataataggcgaccagtttcaccg
A0A3Q2CXC4_BMF-02      gaggcctgcatcgggcagaaacttcagataataggcgaccagtttcaccg
                       **************************************************

A0A3Q2CXC4_BMF-01      ggaacacttacaacag-------------------------ta--tcatc
A0A3Q2CXC4_BMF-02      ggaacacttacaacagatcccaggacagcccttcccccacctagttcacc
                       ****************                         **  *** *

A0A3Q2CXC4_BMF-01      aaaaccaaaggaatcaggggccgctgtggtggcgcatgactgcagctctt
A0A3Q2CXC4_BMF-02      aacacca-----------ggcccttaccctgcctcct-cttcctgtttat
                       ** ****           ****  *    ** * * *   * * * *  *

A0A3Q2CXC4_BMF-01      ctcagcctcctgtttgatagggg---gttgattggtggagcaggatggag
A0A3Q2CXC4_BMF-02      ttctctctcctttcccctgtggtcccgttgtgctgtggaggcaagtggca
                        **   ***** *    *  **    ****    ******     ***  

A0A3Q2CXC4_BMF-01      gtga
A0A3Q2CXC4_BMF-02      ttga
                        ***

© 1998-2020Legal notice