Dataset for CDS BAD of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8WI83_BAD-01      ------------------------------------atggctgcacagtt
A0A3P8WI83_BAD-02      atgaatgtagaagtgtccatctttccagatgtcacaatggctgcacagtt

A0A3P8WI83_BAD-01      cactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaa
A0A3P8WI83_BAD-02      cactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaa

A0A3P8WI83_BAD-01      aaattaagcattcattgaatgacccagaacaggttgtacctcaccggcac
A0A3P8WI83_BAD-02      aaattaagcattcattgaatgacccagaacaggttgtacctcaccggcac

A0A3P8WI83_BAD-01      aacctcaccctacctgagctcagggtggcaggaagtcgtcggatcaggct
A0A3P8WI83_BAD-02      aacctcaccctacctgagctcagggtggcaggaagtcgtcggatcaggct

A0A3P8WI83_BAD-01      aaattcagagtcacatgcttcaaccatttccagagaggaagccttccagt
A0A3P8WI83_BAD-02      aaattcagagtcacatgcttcaaccatttccagagaggaagccttccagt

A0A3P8WI83_BAD-01      cctggggggaggaagaagccggaacgcccacagaaggagctcctttcagg
A0A3P8WI83_BAD-02      cctggggggaggaagaagccggaacgcccacagaaggagctcctttcagg

A0A3P8WI83_BAD-01      ggacggtccaggtcagctcctcctgccctgtgggcagcaaagaagtatgg
A0A3P8WI83_BAD-02      ggacggtccaggtcagctcctcctgccctgtgggcagcaaagaagtatgg

A0A3P8WI83_BAD-01      caggcagctccgcaggatgagtgatgaatttgacagcctgctggacaaag
A0A3P8WI83_BAD-02      caggcagctccgcaggatgagtgatgaatttgacagcctgctggacaaag

A0A3P8WI83_BAD-01      ggatgaggaaggtgaagagcgcaggcacagccagacagatgcaccactcc
A0A3P8WI83_BAD-02      ggatgaggaaggtgaagagcgcaggcacagccagacagatgcaccactcc

A0A3P8WI83_BAD-01      aaaagctggtggagctacctctttagtcaccaggagctggaaggagaaaa
A0A3P8WI83_BAD-02      aaaagctggtggagctacctctttagtcaccaggagctggaaggagaaaa

A0A3P8WI83_BAD-01      caaccatcacgagaaccacactcaccgcactgagtag
A0A3P8WI83_BAD-02      caaccatcacgagaaccacactcaccgcactgagtag

© 1998-2022Legal notice