Dataset for CDS classical BH3-containing proteins of organism Ctenopharyngodon idella

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0P0HZF9_PMAIP1-      atgg----------------------------------------------
A0A8F1NN26_BAD-01       atgg----cac---------------aaatg--ttcagtatctc---tga
A0A8F1NN29_BAD-01       atggataacacattgcatgaccatcaagatgattccagcgccttggatgg
                        ****                                              

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
A0A8F1NN26_BAD-01       caatgagtc------------agagacatcggaagaccgtgaggacccc-
A0A8F1NN29_BAD-01       caaaaagacatcacatctggaagagacaatcaagaaccatgggcaacatc
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
A0A8F1NN26_BAD-01       --gaccagacagaacataacagtggattgccgcaggggaa---gcagctc
A0A8F1NN29_BAD-01       aggatcaaaccttgccaaacatt---tctcctcaaaggcgtgtgcggctc
                                                                          

A0A0P0HZF9_PMAIP1-      --------------------------------------------------
A0A8F1NN26_BAD-01       cgcactgtgcctgatagcctgaaaggcgagcaactgg--ggaggcagaga
A0A8F1NN29_BAD-01       tattcagagtctca-ggtgtatacagtcagccgctggcaggacgcagag-
                                                                          

A0A0P0HZF9_PMAIP1-      -------cgaagaaagagaa------------------------------
A0A8F1NN26_BAD-01       aatctctcgatgaatgaggatctgct--ggaggccggggcagcagatgaa
A0A8F1NN29_BAD-01       -----ccccaggatggagcatcggcggaggagaacggaggagcgggagat
                               * * **  *** *                              

A0A0P0HZF9_PMAIP1-      --------------------------aaccgctgttgtcg----------
A0A8F1NN26_BAD-01       ggcgat---ttcaggcctagatctcgctctgctcctcctgctttgtgggc
A0A8F1NN29_BAD-01       ggacttccattcagaggtcgttctcaatccgctcctgctgcgctgtggaa
                                                    * ***  *   *          

A0A0P0HZF9_PMAIP1-      --------agtgcgcgcaacagttgcgcacaattggagatctctttgac-
A0A8F1NN26_BAD-01       tgctaagaaatatggccgacagctaaggagaatgagcgatgagtttgaca
A0A8F1NN29_BAD-01       agcaaagaagtatgggcggcagctgaggagaatgagcgatgaatttgaca
                                * *  *  *  *** *  * * ***  * ***   ****** 

A0A0P0HZF9_PMAIP1-      -------tggaaatac----aagttactggaaatcat---aatcgcgctc
A0A8F1NN26_BAD-01       tcctccttgataaagggatgaagagggtgaagagcgcaggaacagcacgt
A0A8F1NN29_BAD-01       catggcttgacaaagg------ggaggtgaaaagagt-gaaacagaccta
                               **  **         *    ** * *       **  *  *  

A0A0P0HZF9_PMAIP1-      caga------------------------------------------aagc
A0A8F1NN26_BAD-01       cagatgcagcaatcacccagctggttggccttcctttggagtcacaaaga
A0A8F1NN29_BAD-01       caga--------------ggatggttctcattcctctggagtcccaaaga
                        ****                                          *** 

A0A0P0HZF9_PMAIP1-      g---------cagacggacggaaaaagatga
A0A8F1NN26_BAD-01       gtctgatgctgagtcgcgccctgcagagtga
A0A8F1NN29_BAD-01       a---------gaggagggc---agagaatga
                                   **  *  *     *   ***

© 1998-2022Legal notice