Dataset for CDS BCL2L11 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3H020_BCL2L11-01      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg
G3H020_BCL2L11-02      atggccaagcaaccttctgatgtaagttctgagtgtgacagagaaggtgg

G3H020_BCL2L11-01      acaattgcagcctgctgagaggcctccccagcttaggcctggggccccta
G3H020_BCL2L11-02      acaattgcagcctgctgagaggcctccccagcttaggcctggggccccta

G3H020_BCL2L11-01      cctccctacaaacagaaccgca----------------------------
G3H020_BCL2L11-02      cctccctacaaacagaaccgcaaggtaatccagacggtgacggggaccgc

G3H020_BCL2L11-01      --------------------------------------------------
G3H020_BCL2L11-02      tgcccccacggcagccctcagggcccgctggccccaccggccagccctgg

G3H020_BCL2L11-01      --------------------------------------------------
G3H020_BCL2L11-02      cccttttgctaccagatccccacttttcatctttgtgagaagatcttctc

G3H020_BCL2L11-01      ----------------------------------------agacaggagt
G3H020_BCL2L11-02      tgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagt

G3H020_BCL2L11-01      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg
G3H020_BCL2L11-02      ccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttg

G3H020_BCL2L11-01      ccaggccttcaaccattatctcagtgcaatggcttccataaggcaatctc
G3H020_BCL2L11-02      ccaggccttcaaccattatctcagtgcaatggcttccataaggcaatctc

G3H020_BCL2L11-01      aggaggaacctgcagatatccgcccggagatatggattgcacaggagctt
G3H020_BCL2L11-02      aggaggaacctgcagatatccgcccggagatatggattgcacaggagctt

G3H020_BCL2L11-01      cggcggattggagacgagttcaacgaatcttacagaaggagggcaaataa
G3H020_BCL2L11-02      cggcggattggagacgagttcaacgaatcttacagaaggagggcaaataa

G3H020_BCL2L11-01      ttaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttac
G3H020_BCL2L11-02      ttaccaagaggatgaagaccaccctcaccaccctcaaatggttatcttac

G3H020_BCL2L11-01      aactgttacgcttcatcgtccgtcttgtatggagaaggcattga
G3H020_BCL2L11-02      aactgttacgcttcatcgtccgtcttgtatggagaaggcattga

© 1998-2021Legal notice