Dataset for CDS BMF of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2TYD3_BMF-03      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-01      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-02      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-04      atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A8C2TYD3_BMF-05      atggatcgccccagctacctggaagaggactattctagcctggatgggct
                       **************************************************

A0A8C2TYD3_BMF-03      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C2TYD3_BMF-01      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C2TYD3_BMF-02      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C2TYD3_BMF-04      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C2TYD3_BMF-05      ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                       **************************************************

A0A8C2TYD3_BMF-03      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C2TYD3_BMF-01      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C2TYD3_BMF-02      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C2TYD3_BMF-04      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C2TYD3_BMF-05      gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                       **************************************************

A0A8C2TYD3_BMF-03      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C2TYD3_BMF-01      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C2TYD3_BMF-02      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C2TYD3_BMF-04      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C2TYD3_BMF-05      cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
                       **************************************************

A0A8C2TYD3_BMF-03      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A8C2TYD3_BMF-01      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A8C2TYD3_BMF-02      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A8C2TYD3_BMF-04      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
A0A8C2TYD3_BMF-05      tgtcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccat
                       **************************************************

A0A8C2TYD3_BMF-03      cctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C2TYD3_BMF-01      cctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C2TYD3_BMF-02      cctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C2TYD3_BMF-04      cctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A8C2TYD3_BMF-05      cctcctccagtcaggatgttatgttgccttgtggagtcactgaagagccc
                       **************************************************

A0A8C2TYD3_BMF-03      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A8C2TYD3_BMF-01      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A8C2TYD3_BMF-02      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A8C2TYD3_BMF-04      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
A0A8C2TYD3_BMF-05      cggagactcttctatgggaatgctggttaccgcttacatgtccctccagt
                       **************************************************

A0A8C2TYD3_BMF-03      tggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
A0A8C2TYD3_BMF-01      tggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
A0A8C2TYD3_BMF-02      tggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
A0A8C2TYD3_BMF-04      tggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
A0A8C2TYD3_BMF-05      tggctttgctttggatccaaatctccaagaagagcctcaggaaggtcagc
                       **************************************************

A0A8C2TYD3_BMF-03      gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgca
A0A8C2TYD3_BMF-01      gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgca
A0A8C2TYD3_BMF-02      gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgca
A0A8C2TYD3_BMF-04      gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgca
A0A8C2TYD3_BMF-05      gggaggcacgtactgaggtgcagattgcacggaaattgcagtgcattgca
                       **************************************************

A0A8C2TYD3_BMF-03      gaccagttccaccggctccacatacagcgggataagcacgg-agtactca
A0A8C2TYD3_BMF-01      gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
A0A8C2TYD3_BMF-02      gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
A0A8C2TYD3_BMF-04      gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
A0A8C2TYD3_BMF-05      gaccagttccaccggctccacatacagcggcatcagcagaacagaaatca
                       ****************************** ** ****    ** * ***

A0A8C2TYD3_BMF-03      catacaccagaaaaatcttaagccacaaaacatgcttgtatctaacgtgg
A0A8C2TYD3_BMF-01      agtgtggtggcagcttttt------------ctctttctacacaacttgg
A0A8C2TYD3_BMF-02      agtgtggtggcagcttttt------------ctctttctacacaacttgg
A0A8C2TYD3_BMF-04      agtgtggtggcagcttttt------------ctctttctacacaacttgg
A0A8C2TYD3_BMF-05      agtgtggtggcagcttttt------------ctctttctacacaacttgg
                         *      * *   * **             *  ** **   *** ***

A0A8C2TYD3_BMF-03      tacattgaatgtctaattcatc----actgcgct---cagagg-------
A0A8C2TYD3_BMF-01      --ccttaaatgtggaggcgaacaggaaccgcactgggcagaga-------
A0A8C2TYD3_BMF-02      --ccttaaatgtggaggcgaacaggaaccgcactgggcagaga-------
A0A8C2TYD3_BMF-04      --ccttaaatgtggaggcgaacaggaaccgcactgggcagagg-------
A0A8C2TYD3_BMF-05      --ccttaaatgtggaggcgaacaggaaccgcactgggcagaggagtctcc
                         * ** *****  *    * *    ** ** **   *****        

A0A8C2TYD3_BMF-03      --------------------------------------------------
A0A8C2TYD3_BMF-01      ----------gaaatggagtcatgggggcatagcctgagctctgctctgc
A0A8C2TYD3_BMF-02      ----------gaaatggagtcatgggggcatagcctgagctctgctctgc
A0A8C2TYD3_BMF-04      -----------------------------ataagc---------------
A0A8C2TYD3_BMF-05      ctgatttgtggacgcagctccaggagagcatcatc---------------
                                                                         

A0A8C2TYD3_BMF-03      -------caatcagttcttccagaaagatcaaca-----tccatttcagg
A0A8C2TYD3_BMF-01      tcagtgccagcctgctgtcacaccacctccaccactcggcttcctctggg
A0A8C2TYD3_BMF-02      tcagtgccagcctgctgtcacaccacctccaccactcggcttcctctggg
A0A8C2TYD3_BMF-04      ------acggagtactcacatac-------acca----ga----------
A0A8C2TYD3_BMF-05      ------acagattcttcagctccagtttttatca----gactattatggg
                              *       *              * **                

A0A8C2TYD3_BMF-03      aactg---------------------------------------------
A0A8C2TYD3_BMF-01      cactgctgttcactcgccacccagcgctgttccttgggggctgaaatgcc
A0A8C2TYD3_BMF-02      cactgctgttcactcgccacccagcgctgttccttgggggctgaaatgcc
A0A8C2TYD3_BMF-04      -------------------------------------------------a
A0A8C2TYD3_BMF-05      gagag-----------------accggtgtgacgcaaagacagcgtggta
                                                                         

A0A8C2TYD3_BMF-03      gacttaaccat-----------------tga
A0A8C2TYD3_BMF-01      aagtgcagcctcgtgtggacttgccatgtaa
A0A8C2TYD3_BMF-02      aagtgcagcctcgtgtggacttgccatgtaa
A0A8C2TYD3_BMF-04      aaat-----ct-----------------taa
A0A8C2TYD3_BMF-05      aaattcaccca-----------------tga
                        * *                        * *

© 1998-2022Legal notice