Dataset for CDS classical BH3-containing proteins of organism Chrysemys picta bellii

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3IH53_BAD-01       ------------------------------------atgc-------acc
A0A8C3P5Z9_BMF-01       ------------------------------------atgg-------atc
A0A8C3P5Z9_BMF-02       ------------------------------------atgg-------atc
A0A8C3ILG9_PMAIP1-      ------------------------------------atgcc---------
A0A8C3FX85_BCL2L11      ------------------------------------atggcaaagcaatc
A0A8C3FX85_BCL2L11      atgtcttcctatttctttgcaggaaaaaaagaccaaatggcaaagcaatc
                                                            ***           

A0A8C3IH53_BAD-01       cctt-------------------------------gacaccccccttctc
A0A8C3P5Z9_BMF-01       cccccagctacct---------------ggaagaggactattctagcctg
A0A8C3P5Z9_BMF-02       cccccagctacct---------------ggaagaggactattctagcctg
A0A8C3ILG9_PMAIP1-      --------------------------------------------------
A0A8C3FX85_BCL2L11      ttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaa
A0A8C3FX85_BCL2L11      ttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaa
                                                                          

A0A8C3IH53_BAD-01       ttgcagcgcggcgcccgggcgccatgccccgtccctgagcatgtttc---
A0A8C3P5Z9_BMF-01       gatgggctggacgatgacgtgtttcactctgactttggactcaca-----
A0A8C3P5Z9_BMF-02       gatgggctggacgatgacgtgtttcactctgactttggactcaca-----
A0A8C3ILG9_PMAIP1-      --------------------------------------------------
A0A8C3FX85_BCL2L11      ttgaaaggccaagtcagcctcagcatcttagacctggggcccctacctct
A0A8C3FX85_BCL2L11      ttgaaaggccaagtcagcctcagcatcttagacctggggcccctacctct
                                                                          

A0A8C3IH53_BAD-01       -----------gcatccaggagttc--ccggacgaggtgttcccggggcg
A0A8C3P5Z9_BMF-01       ---------------------ggtcagcctggtgagatgacccctcctgg
A0A8C3P5Z9_BMF-02       ---------------------ggtcagcctggtgagatgacccctcctgg
A0A8C3ILG9_PMAIP1-      ---------------------------------gggaaagaccctgcgca
A0A8C3FX85_BCL2L11      atacaaacacagtatcaaggtaatcattcaggtgagggggacttcgccca
A0A8C3FX85_BCL2L11      atacaaacacagtatcaaggtaatcattcaggtgagggggacttcgccca
                                                         * *     *        

A0A8C3IH53_BAD-01       ---------agggaaggagtcgcctcttccccccgagtcgcagcggggac
A0A8C3P5Z9_BMF-01       cattttcacacagaaccaatcctacagctgtctcctggggaggtttcaac
A0A8C3P5Z9_BMF-02       cattttcacacagaaccaatcctacagctgtctcctggggaggtttcaac
A0A8C3ILG9_PMAIP1-      ---------aggg-------tgcgcagcag--------------------
A0A8C3FX85_BCL2L11      gcagccctcagggagctcttcgcccagcagccctcagggaccatttgcac
A0A8C3FX85_BCL2L11      gcagccctcagggagctcttcgcccagcagccctcagggaccatttgcac
                                 *  *                                     

A0A8C3IH53_BAD-01       acacgtccggctccaagcagccagacacccccacagctgaggtgcgaagc
A0A8C3P5Z9_BMF-01       --------tgttccc---actcacacactgctgtggtccaggtatcaggc
A0A8C3P5Z9_BMF-02       --------tgttccc---actcacacactgctgtggtccaggtatcaggc
A0A8C3ILG9_PMAIP1-      --------agccccg-----------------------------------
A0A8C3FX85_BCL2L11      cacccagtagcccca---gtccatttgctaccagatccccacttttcatc
A0A8C3FX85_BCL2L11      cacccagtagcccca---gtccatttgctaccagatccccacttttcatc
                                 *  **                                    

A0A8C3IH53_BAD-01       cggataggg----------------tcagacccccca-----------tc
A0A8C3P5Z9_BMF-01       atgctgagcagcaggacaaggcaacccaaacactc-----agtccatcct
A0A8C3P5Z9_BMF-02       atgctgagcagcaggacaaggcaacccaaacactc-----agtccatcct
A0A8C3ILG9_PMAIP1-      -----------------------------------------------ctc
A0A8C3FX85_BCL2L11      tttgtaagaagatcctcactgctgtctagatcctccagtgggtatttctc
A0A8C3FX85_BCL2L11      tttgtaagaagatcctcactgctgtctagatcctccagtgggtatttctc
                                                                          

A0A8C3IH53_BAD-01       tctggagccagaagtgcaggatgagccaggtggggcattccgggcacgct
A0A8C3P5Z9_BMF-01       cttccactcaggatgtcatgttgccat-gtggagtcactgaagagcccca
A0A8C3P5Z9_BMF-02       cttccactcaggatgtcatgttgccat-gtggagtcactgaagagcccca
A0A8C3ILG9_PMAIP1-      ccgcagcacaggaagctgtgatgc--------------------------
A0A8C3FX85_BCL2L11      tttcgacacagacaggagtcctgcgcc-tatgagttgcgacaagtccacg
A0A8C3FX85_BCL2L11      tttcgacacagacaggagtcctgcgcc-tatgagttgcgacaagtccacg
                                ***          **                           

A0A8C3IH53_BAD-01       cacgctc-----------------------------agccccccccatcc
A0A8C3P5Z9_BMF-01       gagactcttctatgggaatgctgggtaccgtttacatgtccccccagttg
A0A8C3P5Z9_BMF-02       gagactcttctatgggaatgctgggtaccgtttacatgtccccccagttg
A0A8C3ILG9_PMAIP1-      ------------------------------------agtgctcttcgcaa
A0A8C3FX85_BCL2L11      cagactc---------------------------caagtcccccttgtca
A0A8C3FX85_BCL2L11      cagactc---------------------------caagtcccccttgtca
                                                             *  * *       

A0A8C3IH53_BAD-01       tttgggctgccatgcgttacgggcgggaactgcgcaggatgagtgatgag
A0A8C3P5Z9_BMF-01       gctttgcattgaatccacacctccaagaggagcctcgggaaggtca----
A0A8C3P5Z9_BMF-02       gctttgcattgaatccacacctccaagaggagcctcgggaaggtca----
A0A8C3ILG9_PMAIP1-      ----------------ctacgcaaaatagg----------agat------
A0A8C3FX85_BCL2L11      agcctttaatcattatctaagtgcaatggg----taagcaagatcatgct
A0A8C3FX85_BCL2L11      agcctttaatcattatctaagtgcaatggg----taagcaagatcatgct
                                          *                        *      

A0A8C3IH53_BAD-01       tttg---------------------------acgtggcgc----------
A0A8C3P5Z9_BMF-01       -------------------------------acgggaagcacgtactgag
A0A8C3P5Z9_BMF-02       -------------------------------acgggaagcacgtactgag
A0A8C3ILG9_PMAIP1-      -------------------------------atatgcaac----------
A0A8C3FX85_BCL2L11      tccaggtgggagtcaccctcagtacgtgaagacatgcagc-----cggaa
A0A8C3FX85_BCL2L11      tccaggtgggagtcaccctcagtacgtgaagacatgcagc-----cggaa
                                                       *   *   *          

A0A8C3IH53_BAD-01       ----------tgcaggtgctgccacgccccaagagtgcaggcacaacatc
A0A8C3P5Z9_BMF-01       gttcagattgcacggaagttacagtgcatt-gcagaccagttccacaggc
A0A8C3P5Z9_BMF-02       gttcagattgcacggaagttacagtgcatt-gcagaccagttccacaggc
A0A8C3ILG9_PMAIP1-      ------------------ctgcagc--------agaagattcttaatgtt
A0A8C3FX85_BCL2L11      atatggattgcacaggaactgcggcgtatt-ggagatgagt-ttaatgct
A0A8C3FX85_BCL2L11      atatggattgcacaggaactgcggcgtatt-ggagatgagt-ttaatgct
                                           * *           **   *     *     

A0A8C3IH53_BAD-01       -ccagctgcaccggggg------------------aacagctggaaagaa
A0A8C3P5Z9_BMF-01       tccacatacagagg--------------------catcagcagaacagaa
A0A8C3P5Z9_BMF-02       tccacatacagagg--------------------catcagcagaacagaa
A0A8C3ILG9_PMAIP1-      -------------------------------------------attacaa
A0A8C3FX85_BCL2L11      tcctattgcccaagaaggggtttcttggataatccagcagtaaaccacca
A0A8C3FX85_BCL2L11      tcctattgcccaagaaggggtttcttggataatccagcagtaaaccacca
                                                                      *  *

A0A8C3IH53_BAD-01       acc---------------ctccaggcctggttgggacacagacccgcccg
A0A8C3P5Z9_BMF-01       atcaagtgtggtggcagatccttctcttcct----------------aca
A0A8C3P5Z9_BMF-02       atcaagtgtggtggcagatccttctcttcct----------------aca
A0A8C3ILG9_PMAIP1-      aac-------------tgttctgc-ccagga----------------acg
A0A8C3FX85_BCL2L11      aat-------------tattttgcgcctgtt----------------acg
A0A8C3FX85_BCL2L11      aat-------------tattttgcgcctgtt----------------acg
                        *                        *                      * 

A0A8C3IH53_BAD-01       tgatgccccccccaggagctccaaa-------------------------
A0A8C3P5Z9_BMF-01       taa----cttggccttaaatgtggaggcaaacaggaaccacgtaggtcag
A0A8C3P5Z9_BMF-02       taa----cttggccttaaatgtggaggcaaacaggaaccacgtaggtcag
A0A8C3ILG9_PMAIP1-      tga-----------------------------------------------
A0A8C3FX85_BCL2L11      ttatatcatccgcctcatttggaga----------------------ctg
A0A8C3FX85_BCL2L11      ttatatcatccgcctcatttggaga----------------------ctg
                        * *                                               

A0A8C3IH53_BAD-01       ---tga
A0A8C3P5Z9_BMF-01       aggtga
A0A8C3P5Z9_BMF-02       aggtga
A0A8C3ILG9_PMAIP1-      ------
A0A8C3FX85_BCL2L11      cagtaa
A0A8C3FX85_BCL2L11      cagtaa
                              

© 1998-2022Legal notice