Dataset for CDS BCL2L11 of organism Chrysemys picta bellii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3FX85_BCL2L11      ------------------------------------atggcaaagcaatc
A0A8C3FX85_BCL2L11      atgtcttcctatttctttgcaggaaaaaaagaccaaatggcaaagcaatc
                                                            **************

A0A8C3FX85_BCL2L11      ttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaa
A0A8C3FX85_BCL2L11      ttctgatctaaattcagagtgcaacagagaaggtggacagtttcagtcaa
                        **************************************************

A0A8C3FX85_BCL2L11      ttgaaaggccaagtcagcctcagcatcttagacctggggcccctacctct
A0A8C3FX85_BCL2L11      ttgaaaggccaagtcagcctcagcatcttagacctggggcccctacctct
                        **************************************************

A0A8C3FX85_BCL2L11      atacaaacacagtatcaaggtaatcattcaggtgagggggacttcgccca
A0A8C3FX85_BCL2L11      atacaaacacagtatcaaggtaatcattcaggtgagggggacttcgccca
                        **************************************************

A0A8C3FX85_BCL2L11      gcagccctcagggagctcttcgcccagcagccctcagggaccatttgcac
A0A8C3FX85_BCL2L11      gcagccctcagggagctcttcgcccagcagccctcagggaccatttgcac
                        **************************************************

A0A8C3FX85_BCL2L11      cacccagtagccccagtccatttgctaccagatccccacttttcatcttt
A0A8C3FX85_BCL2L11      cacccagtagccccagtccatttgctaccagatccccacttttcatcttt
                        **************************************************

A0A8C3FX85_BCL2L11      gtaagaagatcctcactgctgtctagatcctccagtgggtatttctcttt
A0A8C3FX85_BCL2L11      gtaagaagatcctcactgctgtctagatcctccagtgggtatttctcttt
                        **************************************************

A0A8C3FX85_BCL2L11      cgacacagacaggagtcctgcgcctatgagttgcgacaagtccacgcaga
A0A8C3FX85_BCL2L11      cgacacagacaggagtcctgcgcctatgagttgcgacaagtccacgcaga
                        **************************************************

A0A8C3FX85_BCL2L11      ctccaagtcccccttgtcaagcctttaatcattatctaagtgcaatgggt
A0A8C3FX85_BCL2L11      ctccaagtcccccttgtcaagcctttaatcattatctaagtgcaatgggt
                        **************************************************

A0A8C3FX85_BCL2L11      aagcaagatcatgcttccaggtgggagtcaccctcagtacgtgaagacat
A0A8C3FX85_BCL2L11      aagcaagatcatgcttccaggtgggagtcaccctcagtacgtgaagacat
                        **************************************************

A0A8C3FX85_BCL2L11      gcagccggaaatatggattgcacaggaactgcggcgtattggagatgagt
A0A8C3FX85_BCL2L11      gcagccggaaatatggattgcacaggaactgcggcgtattggagatgagt
                        **************************************************

A0A8C3FX85_BCL2L11      ttaatgcttcctattgcccaagaaggggtttcttggataatccagcagta
A0A8C3FX85_BCL2L11      ttaatgcttcctattgcccaagaaggggtttcttggataatccagcagta
                        **************************************************

A0A8C3FX85_BCL2L11      aaccaccaaattattttgcgcctgttacgttatatcatccgcctcatttg
A0A8C3FX85_BCL2L11      aaccaccaaattattttgcgcctgttacgttatatcatccgcctcatttg
                        **************************************************

A0A8C3FX85_BCL2L11      gagactgcagtaa
A0A8C3FX85_BCL2L11      gagactgcagtaa
                        *************

© 1998-2022Legal notice