Dataset for CDS classical BH3-containing proteins of organism Chlorocebus sabaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0D9S003_PMAIP1-      ----------------------------------atgcctgggaagaagg
A0A0D9QZY8_BIK-01       ------atgtctggagtaagacccatctccagacacatcttgatggagag
A0A0D9RWE0_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A0D9R4R5_BMF-01       atggagccatctcggtgtgtggaggagctggaggatga-tgtg-------
A0A0D9R491_BAD-01       ------atgttccag---atcccagagtttgagcctag-tgagcaggaag
A0A0D9S2H2_BBC3-01      -----caggccccagggagcgccatggcccgcgcacgc-caggagggcag
A0A0D9SC73_HRK-01       -----------------------atg------------------------

A0A0D9S003_PMAIP1-      c-------------------------------------------------
A0A0D9QZY8_BIK-01       cctcctg---tatgagcagc--------------tcctggaacccctgac
A0A0D9RWE0_BCL2L11      acaattgcagcctgcggaga--------------ggcc------------
A0A0D9R4R5_BMF-01       -ttccagccggaggacggag--------------agccgggggcccaacc
A0A0D9R491_BAD-01       actccagctctgcagagagg--------------ggcctgggccccagcc
A0A0D9S2H2_BBC3-01      ctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcc
A0A0D9SC73_HRK-01       ----------------------------------tgcccgtgccccctgc

A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A0D9QZY8_BIK-01       catggaggttcttggtgtgactgaccctga---------------agagg
A0A0D9RWE0_BCL2L11      -----------------tccccagc--------------------tcaga
A0A0D9R4R5_BMF-01       cgggagctcgc------tctctgccgatct---------------gtttg
A0A0D9R491_BAD-01       ccgcagggaac--aggccctcagactccgg---caagcatcatcaccagg
A0A0D9S2H2_BBC3-01      cgctcggccgcctggtgccctcggcagtgt---cctgcggcctctgcgag
A0A0D9SC73_HRK-01       accgcggccgc---ggccccccggccgtgtgcgcctgcagc----gcggg

A0A0D9S003_PMAIP1-      ------------------------------------------------gc
A0A0D9QZY8_BIK-01       acctggaccctatggaggacttcgatcctttggagtgtatggaggacagt
A0A0D9RWE0_BCL2L11      cctggggccc--------ctacctccctacagacagagccacaagacagg
A0A0D9R4R5_BMF-01       cccagagcctactt--gactgccc--cctcagccgactt-------cagc
A0A0D9R491_BAD-01       ccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagc
A0A0D9S2H2_BBC3-01      ccc--ggcct------ggctgccg--cccccgccgcccccgccctgctgc
A0A0D9SC73_HRK-01       tc----gctt------gg-ggctg--cgctcg-----tccgccgcgcagc

A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------gacatgttggcc
A0A0D9RWE0_BCL2L11      ----------------------------------------------agcc
A0A0D9R4R5_BMF-01       -----------------------tcttccctctcacccactgctgtggcc
A0A0D9R491_BAD-01       -------------------------------agcagccatcatggaggcg
A0A0D9S2H2_BBC3-01      ccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgcc
A0A0D9SC73_HRK-01       ---------------------------------------tcaccgccgcc

A0A0D9S003_PMAIP1-      ---------------------gcaagaacgcgcaaccgagcccaacgcgg
A0A0D9QZY8_BIK-01       ctg--cggctggcctgcatcggggacgagatggacgtgagcctcagggcc
A0A0D9RWE0_BCL2L11      cag------cacccatgagttgtgacaaatcaacacaaaccccaagtcct
A0A0D9R4R5_BMF-01       ctggccttcgacccaccagccaggaagacaag-----gctacccagac--
A0A0D9R491_BAD-01       ctgggg-------------ctgtggagacccggagtcg---ccacagc--
A0A0D9S2H2_BBC3-01      ctggggggcccccgctggcctgggggtccccgcagccggccccgaggc--
A0A0D9SC73_HRK-01       cgg-------------------------------------ctcaaggc--

A0A0D9S003_PMAIP1-      gctca-------------------------------------------gg
A0A0D9QZY8_BIK-01       ccgcgcctggcccagctc----------------------tctgaggtgg
A0A0D9RWE0_BCL2L11      ccttgcc----aggccttcaacca--------------------ctatct
A0A0D9R4R5_BMF-01       ccttggcccagcctcccccagccaaggtgtcatgctgccttgtggggtaa
A0A0D9R491_BAD-01       tcctaccccgcggggacggaggaggacgaag-------------ggatgg
A0A0D9S2H2_BBC3-01      ccacgcccggacggtcctcagccctcgcttt-------------cgctgg
A0A0D9SC73_HRK-01       gcttggc--gacgagctgca-ccagcgcacc-------------atgtgg

A0A0D9S003_PMAIP1-      cagagc------------------tcgaagtcgagtgtgctactcaactc
A0A0D9QZY8_BIK-01       ccatgcacagcctgggtctggctttcatctacgaccagacggacgacatc
A0A0D9RWE0_BCL2L11      cagtgcaa-----------------------------------tggcttc
A0A0D9R4R5_BMF-01       ctgaggaaccccagcgactcttttacggcaatg--ctggctaccggcttc
A0A0D9R491_BAD-01       aggaggagccc-----agccccttccggggccg--ctcgcgctccgcgcc
A0A0D9S2H2_BBC3-01      cggagcagcac-------------ctggagtcg--cccgtgcccagcgcc
A0A0D9SC73_HRK-01       cggcgccgcgc-------------gcggagccg--gagggcgccggcgcc
                            *                                            *

A0A0D9S003_PMAIP1-      a-----------------------------------------ggagattt
A0A0D9QZY8_BIK-01       agggatgttc-------ttagaagtttcatagatggtttcaccaccctta
A0A0D9RWE0_BCL2L11      caggaggc---------aggctgaacctgcagatatgcgcccggagatac
A0A0D9R4R5_BMF-01       ctctccctgccagtttcccggcagtcttgcccatcggggagcagcccccc
A0A0D9R491_BAD-01       ccccaacctctgg----gcag----cacagcgttatggccgcgagc-tcc
A0A0D9S2H2_BBC3-01      ccgggggccctgg----cgggcggtcccacccaggcggccccgggagtcc
A0A0D9SC73_HRK-01       cggcgcgctc---------------cccaccta-ctggccctggctgtgc

A0A0D9S003_PMAIP1-      ggag----------------------------------------------
A0A0D9QZY8_BIK-01       gggagaacataatgaggt------------tctggagatccctgaatccc
A0A0D9RWE0_BCL2L11      gga-----------------------------------------------
A0A0D9R4R5_BMF-01       gaaggg--------cagtggcaacatcgagcagaggtacagattgcccga
A0A0D9R491_BAD-01       ggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccg
A0A0D9S2H2_BBC3-01      gcggggaggaggaacagtgggcccaggagatcggggcccagctgcggcgg
A0A0D9SC73_HRK-01       gcgg----------------------------------------------

A0A0D9S003_PMAIP1-      ----------------acaaactgaacttcc-ggcagaaacttctgaatc
A0A0D9QZY8_BIK-01       gggtcctgggtgtcccgcgaacaggtgctgctggcgctgctgctgctggc
A0A0D9RWE0_BCL2L11      ----------------tcgcccaagagttgc-ggcgaa----------tc
A0A0D9R4R5_BMF-01       aagcttcagtgcattgcagaccagttccacc-ggctc---catgtgcagc
A0A0D9R491_BAD-01       aaga--------------gcgcgggcacagc-gacgcagat-------gc
A0A0D9S2H2_BBC3-01      atggcggacgacctcaacgcgcagtacgagc-ggcggagacaagaggagc
A0A0D9SC73_HRK-01       ----------------ccgcgcag-----gt-ggcg------------gc
                                             *          * *              *

A0A0D9S003_PMAIP1-      --tgatagccaaac--------------tcttctgctcaggaacc-----
A0A0D9QZY8_BIK-01       actgctgctggcgctg------------ctca----gcgggggcctgcac
A0A0D9RWE0_BCL2L11      ggagacgagtttaacg------------cttactatgcaagga-------
A0A0D9R4R5_BMF-01       aacaccagcagaaccgaaatcg------catgtggtggcagatcctc---
A0A0D9R491_BAD-01       ggcaaagctccagctggacgcgagtcttccagtcctggtgggatcgg---
A0A0D9S2H2_BBC3-01      agcagcgacaccgccc------------ctcgccctggagggtcctgtac
A0A0D9SC73_HRK-01       gctggcggcctggctg------------ctcggca-ggcggaacttg---

A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A0D9QZY8_BIK-01       ctgct---------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------ggttagagaaa-------------
A0A0D9R4R5_BMF-01       ---ctcttcctgcacaaccttgctttgaatggagaagagaacaggaacgg
A0A0D9R491_BAD-01       ---------------------aacttgggcaggggaagctccgccccc--
A0A0D9S2H2_BBC3-01      aatctcatcatgggactcctgcccttacccaggggccacagagcccccga
A0A0D9SC73_HRK-01       --------------------------------------------------

A0A0D9S003_PMAIP1-      ----------------
A0A0D9QZY8_BIK-01       ------gctcaagtga
A0A0D9RWE0_BCL2L11      -------------tag
A0A0D9R4R5_BMF-01       ggcgggccctaggtga
A0A0D9R491_BAD-01       -------tcccagtga
A0A0D9S2H2_BBC3-01      aatggagcccaattag
A0A0D9SC73_HRK-01       -------------tag

© 1998-2020Legal notice