Dataset for CDS classical BH3-containing proteins of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

22 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5NJZ2_PMAIP1-      atg-----------------------------------------------
A0A2K5NJZ2_PMAIP1-      atg-----------------------------------------------
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5NTQ5_BCL2L11      atgg------------------caaagcaaccttctgatgtaagttctga
A0A2K5LDM6_BIK-01       atgtctggagtaagacccatctccagagacacctggatggagaccctcct
A0A2K5MJW4_BMF-01       atgg---------------------------------agcc-atctcggt
A0A2K5MJW4_BMF-02       atgg---------------------------------agcc-atctcggt
A0A2K5M0A7_BAD-02       atgt---------------------------------tccagatcccaga
A0A2K5M0A7_BAD-01       atgt---------------------------------tccagatcccaga
A0A2K5M0A7_BAD-03       atgt---------------------------------tccagatcccaga
A0A2K5KZ69_HRK-01       atg-----------------------------------------------
A0A2K5P2T8_BBC3-02      ataa---------------------------------aatttggcgtggg
A0A2K5P2T8_BBC3-01      ataa---------------------------------aatttggcgtggg
A0A2K5P2T8_BBC3-03      ataa---------------------------------aatttggcgtggg
                        **                                                

A0A2K5NJZ2_PMAIP1-      -------------------cctgggaagaaggcgcgcaagaacgcgcaac
A0A2K5NJZ2_PMAIP1-      -------------------cctgggaagaaggcgcgcaagaacgcgcaac
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5NTQ5_BCL2L11      gtgtgaccgagaaggtagacaattgcagcctgcggagaggcctccccagc
A0A2K5LDM6_BIK-01       gtatgagcagctcctggaaccccta-accatggagg-------ttcttgg
A0A2K5MJW4_BMF-01       gtgtgga----------------gg-agctggaggatgatgtgttccagc
A0A2K5MJW4_BMF-02       gtgtgga----------------gg-agctggaggatgatgtgttccagc
A0A2K5M0A7_BAD-02       gtttgagc-----------ctagtg-agcaggaaga-------ctccagc
A0A2K5M0A7_BAD-01       gtttgagc-----------ctagtg-agcaggaaga-------ctccagc
A0A2K5M0A7_BAD-03       gtttgagc-----------ctagtg-agcaggaaga-------ctccagc
A0A2K5KZ69_HRK-01       ---t--gc-----------c--------cgtgc----------cccctgc
A0A2K5P2T8_BBC3-02      gtct--gc-----------c--------cgggcatg-------tccatgc
A0A2K5P2T8_BBC3-01      gtct--gc-----------c--------cgggcatg-------tccatgc
A0A2K5P2T8_BBC3-03      gtct--gc-----------c--------cgggcatg-------tccatgc
                                                       *                  

A0A2K5NJZ2_PMAIP1-      cgag------------------------cccaatgcgggctcaggcag--
A0A2K5NJZ2_PMAIP1-      cgag------------------------cccaatgcgggctcaggcagga
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5NTQ5_BCL2L11      tcag---------------acctggggcccctacctcc------------
A0A2K5LDM6_BIK-01       tgtgactgaccctgaagaggacctggacccta---tggaggacttcgatc
A0A2K5MJW4_BMF-01       cgga-------ggacggggagccaggggcccaacccgg--------gagc
A0A2K5MJW4_BMF-02       cgga-------ggacggggagccaggggcccaacccgg--------gagc
A0A2K5M0A7_BAD-02       tctg-------cagagaggggcctgggccccagtctcgcgggggacaggc
A0A2K5M0A7_BAD-01       tctg-------cagagaggggcctgggccccagtctcgcgggggacaggc
A0A2K5M0A7_BAD-03       tctg-------cagagaggggcctgggccccagtctcgcgggggacaggc
A0A2K5KZ69_HRK-01       accg-------c-------ggccgcggccccccggccgtgtg--------
A0A2K5P2T8_BBC3-02      cagg-------t-------gcccagggc------------tg--------
A0A2K5P2T8_BBC3-01      cagg-------t-------gcccagggc------------tg--------
A0A2K5P2T8_BBC3-03      cagg-------t-------gcccagggc------------tg--------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      caggcagggacggcagggacggcgagggaccaggccggatttgggattgg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaag---------------------
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaag---------------------
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaag---------------------
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccaca-----------------------
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5NTQ5_BCL2L11      -------ctacagacaga---gccacaaggtaatcccgaaggcaatcacg
A0A2K5LDM6_BIK-01       ctttggagtgtatggaggacagtgacatgttggccctgcggctg------
A0A2K5MJW4_BMF-01       tcgctctctgccg-----------atctgtttgcccagagcct-------
A0A2K5MJW4_BMF-02       tcgctctctgccg-----------atctgtttgcccagagcct-------
A0A2K5M0A7_BAD-02       cctcagactgcggcaagc---atcatc-gccaggccccaggcc-------
A0A2K5M0A7_BAD-01       cctcagactgcggcaagc---atcatc-gccaggccccaggcc-------
A0A2K5M0A7_BAD-03       cctcagactgcggcaagc---atcatc-gccaggccccaggcc-------
A0A2K5KZ69_HRK-01       ----cgactgcagcgcgg---gtcgtttg---gggctgc-----------
A0A2K5P2T8_BBC3-02      ----cttctgcgacgtgg---gtcctctgccagatttgt-----------
A0A2K5P2T8_BBC3-01      ----cttctgcgacgtgg---gtcctctgccagatttgtggccccaggga
A0A2K5P2T8_BBC3-03      ----cttctgcgacgtgg---gtcctctgccagatttgt-----------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      gatgc---------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5NTQ5_BCL2L11      gaggtgaagggg--------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      gcgccatggcccgcgcacgccaggagggcagctctccggagcccgtagag
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ggcctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgcc
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccg
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ccgcccccgccctgctgcccgctgcctacctctgcgcccccaccgcccca
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cccgccgtcaccgccgccctggggggcccccgctggcctgggggtccccg
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------agctgc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5NTQ5_BCL2L11      --------------------------------------------acagct
A0A2K5LDM6_BIK-01       --------------------------------------------gcctgc
A0A2K5MJW4_BMF-01       --------------------------------------------acttga
A0A2K5MJW4_BMF-02       --------------------------------------------acttga
A0A2K5M0A7_BAD-02       --------------------------------------------tcctgt
A0A2K5M0A7_BAD-01       --------------------------------------------tcctgt
A0A2K5M0A7_BAD-03       --------------------------------------------tcctgt
A0A2K5KZ69_HRK-01       --------------------------------------------gctcgt
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cagccggccccgaggcccacgcccggacggtcctcagccctcgctcttgc
A0A2K5P2T8_BBC3-03      ----------------------------ggtcctcagccctcgctcttgc
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      atttcaccagaggcaaagagctcgtctcctcctccccacttgcc------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5NTQ5_BCL2L11      gcccccacggcagccctcagggcccgctggccccaccggccagc------
A0A2K5LDM6_BIK-01       atcggggacgagatggatgtgagcctcagggccccgcgcctggc------
A0A2K5MJW4_BMF-01       ----ctgccccctcagccgacttcagctcttccctctcacccac------
A0A2K5MJW4_BMF-02       ----ctgccccctcagccgacttcagctcttccctctcacccac------
A0A2K5M0A7_BAD-02       ----gggacgc-----cagtcaccagcaggagcagccaaccagc-----a
A0A2K5M0A7_BAD-01       ----gggacgc-----cagtcaccagcaggagcagccaaccagc-----a
A0A2K5M0A7_BAD-03       ----gggacgc-----cagtcaccagcaggagcagccaaccagc-----a
A0A2K5KZ69_HRK-01       ----ccgccgc-----gcagc--------tcaccgccgcccggc------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ----tggcgga-----gcagcacctggagtcgcccgtgcccagcgccccg
A0A2K5P2T8_BBC3-03      ----tggcgga-----gcagcacctggagtcgcccgtgcccagcgccccg
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       ccagctctctgaggtgg---------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       gcagccatcatggaggg---------------------------------
A0A2K5M0A7_BAD-01       gcagccatcatgg-------------------------------------
A0A2K5M0A7_BAD-03       gcagccatcatggagggggagcttggtattctccttcttgggaatctgag
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ggggccctggcgggcgg---------------------------------
A0A2K5P2T8_BBC3-03      ggggccctggcgggcgg---------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       gactctgaaaatcccagtgcaaggatgctcgcggaagcatcagcacggat
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5NTQ5_BCL2L11      ------------------------------------------cctggccc
A0A2K5LDM6_BIK-01       -------------------------------------------------c
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       ------------------------acttcctcgcccgaagagcgcgggca
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       gtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagc
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      ---tcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
A0A2K5P2T8_BBC3-03      ---tcccacccaggcggccccgggagtccgcggggaggaggaacagtggg
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      -----------------------------------------cttccgcgg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5NTQ5_BCL2L11      ttttgctaccagatccccgcttttcatctttatgagaagatcctccctgc
A0A2K5LDM6_BIK-01       catgcacagcctgggtctggc--------------------tttcatctg
A0A2K5MJW4_BMF-01       ------tgctgtggccctggc--------------------cttcgaccc
A0A2K5MJW4_BMF-02       ------tgctgtggccctggc--------------------cttcgaccc
A0A2K5M0A7_BAD-02       cagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcc
A0A2K5M0A7_BAD-01       ---aggcgctggggctgtggagacccgg--agtcgccacagctcctaccc
A0A2K5M0A7_BAD-03       tgaaggcgctggggctgtggagacccgg--agtcgccacagctcctaccc
A0A2K5KZ69_HRK-01       tcaaggcgcttggcgacgagctgc--------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
A0A2K5P2T8_BBC3-03      cccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcg
                                                                          

A0A2K5NJZ2_PMAIP1-      -----------------------agctc----gaagtcgagtgtgctact
A0A2K5NJZ2_PMAIP1-      ggccgcgaggaacaagtgcaagtagctc----gaagtcgagtgtgctact
A0A2K5NTQ5_BCL2L11      ---------------------------------------a--caggagcc
A0A2K5NTQ5_BCL2L11      ---------------------------------------a--caggagcc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5NTQ5_BCL2L11      -------------------------------------aga--caggagcc
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5NTQ5_BCL2L11      tgtctcgatcctccagtgggtatttctcttttgacacaga--caggagcc
A0A2K5LDM6_BIK-01       cgaccagacggacgacatcagggatgttcttagaagtttcatggatggtt
A0A2K5MJW4_BMF-01       ----accagccaggaagacaagg---------ccacccagaccctcggcc
A0A2K5MJW4_BMF-02       ----accagccaggaagacaagg---------ccacccagaccctcggcc
A0A2K5M0A7_BAD-02       tggtgggatcg--------gaac---------ttgggcag--gggaagct
A0A2K5M0A7_BAD-01       cgcggggacggaggaggacgaag---------ggatggag--gaggagcc
A0A2K5M0A7_BAD-03       cgcggggacggaggaggacgaag---------ggatggag--gaggagcc
A0A2K5KZ69_HRK-01       -----------------accagc---------gcaccatg--tggcggcg
A0A2K5P2T8_BBC3-02      --------------gagacaaga---------ggagca-g--cagcgaca
A0A2K5P2T8_BBC3-01      cagtacgagcggcggagacaaga---------ggagca-g--cagcgaca
A0A2K5P2T8_BBC3-03      cagtacgagcggcggagacaaga---------ggagca-g--cagcgaca
                                                                          

A0A2K5NJZ2_PMAIP1-      caactcaggagatttggagacaaactgaacttccggcagaaacttctgaa
A0A2K5NJZ2_PMAIP1-      caactcaggagatttggagacaaactgaacttccggcagaaacttctgaa
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5NTQ5_BCL2L11      cagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgc
A0A2K5LDM6_BIK-01       tcaccacccttagggagaacataatgaggt--tctggagat---------
A0A2K5MJW4_BMF-01       cagcctcccccagccaaggtgtcatgctgc--cttgtggggtaactgagg
A0A2K5MJW4_BMF-02       cagcctcccccagccaaggtgtcatgctgc--cttgtggggtaactgagg
A0A2K5M0A7_BAD-02       ccgccccc----tcc-cagtgaccttc-gc--tccacgc-----------
A0A2K5M0A7_BAD-01       cagcccct----ttcggggccgctcgc-gc--tccgcgc-----------
A0A2K5M0A7_BAD-03       cagcccct----ttcggggccgctcgc-gc--tccgcgc-----------
A0A2K5KZ69_HRK-01       ccgcgcgcggagccggagggcgccggc-gc--ccggcgcgctccccac--
A0A2K5P2T8_BBC3-02      ccgcccctcgccctggagg---------gt--cctgtacaatctcatcat
A0A2K5P2T8_BBC3-01      ccgcccctcgccctggagg---------gt--cctgtacaatctcatcat
A0A2K5P2T8_BBC3-03      ccgcccctcgccctggagg---------gt--cctgtacaatctcatcat
                                                                          

A0A2K5NJZ2_PMAIP1-      t---ctgatagccaaactct------------------------------
A0A2K5NJZ2_PMAIP1-      t---ctgatagccaaactct------------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5NTQ5_BCL2L11      caggccttcaaccactatctc-----------------------------
A0A2K5LDM6_BIK-01       ----ccccgaatcccaggtcc-----------------------------
A0A2K5MJW4_BMF-01       aaccccagcgactct-----------------------------------
A0A2K5MJW4_BMF-02       aaccccagcgactct-----------------------------------
A0A2K5M0A7_BAD-02       ----cccgaaactccacccgctctcactgtcctggtcggccatcttggat
A0A2K5M0A7_BAD-01       ----cccccaacctc-----------------------------------
A0A2K5M0A7_BAD-03       ----cccccaacctc-----------------------------------
A0A2K5KZ69_HRK-01       ----ctactggccctggctg------------------------------
A0A2K5P2T8_BBC3-02      gggactcctgcccttaccca------------------------------
A0A2K5P2T8_BBC3-01      gggactcctgcccttaccca------------------------------
A0A2K5P2T8_BBC3-03      gggactcctgcccttaccca------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      -tctgctcaggaacctga--------------------------------
A0A2K5NJZ2_PMAIP1-      -tctgctcaggaacctgactgc----------------------------
A0A2K5NTQ5_BCL2L11      -agtgcaatggtagtcattctggaggatataggtgatagttcattgt---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----at-----gag--------------------gc---
A0A2K5NTQ5_BCL2L11      ---------------cttccaggag--------------------gc---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----tt---------------------------------
A0A2K5NTQ5_BCL2L11      -agtgcaat-----------------------------------------
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----cttccaggag--------------------gc---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----cttccaggag--------------------gc---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----cttccaggag--------------------gc---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----cttccaggag--------------------gc---
A0A2K5NTQ5_BCL2L11      -agtgcaatgg----ctaactgg---------------------------
A0A2K5LDM6_BIK-01       -tgggtgt------------------------------------------
A0A2K5MJW4_BMF-01       -tttacg-------------------------------------------
A0A2K5MJW4_BMF-02       -tttacggcaatgctggctaccggcttcctctccctgccagtttcccggc
A0A2K5M0A7_BAD-02       atgggcggaagtgcttccctcaggc-------------------------
A0A2K5M0A7_BAD-01       -tgggcagcacagcgt---tatggc-------------------------
A0A2K5M0A7_BAD-03       -tgggcagcacagcgt---tatggc-------------------------
A0A2K5KZ69_HRK-01       -tgcgcggccgcgc------------------------------------
A0A2K5P2T8_BBC3-02      -ggggccacagagcccccgaaatgg-------------------------
A0A2K5P2T8_BBC3-01      -ggggccacagagcccccgaaatgg-------------------------
A0A2K5P2T8_BBC3-03      -ggggccacagagcccccgaaatgg-------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       agtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgag
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      ------------------atcaaacacttgcataaggggactccaaaaga
A0A2K5NTQ5_BCL2L11      ------------------ggtttggatttatatttactggcttagatttg
A0A2K5NTQ5_BCL2L11      ------------------cactggatcct---------ccctcagaattg
A0A2K5NTQ5_BCL2L11      ------------------aggctgaacctgcagatatgcgcccggagata
A0A2K5NTQ5_BCL2L11      -------------------------------------------agagaaa
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ------------------aggctgaacctgcagatatgcgcccggagata
A0A2K5NTQ5_BCL2L11      ------------------aggctgaacctgcagatatgcgcccggagata
A0A2K5NTQ5_BCL2L11      ------------------aggctgaacctgcagatatgcgcccggagata
A0A2K5NTQ5_BCL2L11      ------------------aggctgaacctgcagatatgcgcccggagata
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       ------------------cccatgaacaggtgctgctgctgctggc----
A0A2K5MJW4_BMF-01       ------------------caccagcagaaccgaaatcgcgtgtggt----
A0A2K5MJW4_BMF-02       cggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtggt----
A0A2K5M0A7_BAD-02       ------------------cttatgcaaaagaggatccgtgctgcctcttt
A0A2K5M0A7_BAD-01       ------------------cgcgagctccggaggatgagtgacgagtttgt
A0A2K5M0A7_BAD-03       ------------------cgcgagctccggaggatga-------------
A0A2K5KZ69_HRK-01       ---------------------------aggtggcggcgctggcggcctgg
A0A2K5P2T8_BBC3-02      ------------------agcccaattaggtgcctgcacccgcccggtgg
A0A2K5P2T8_BBC3-01      ------------------agcccaattaggtgcctgcacccgcccggtgg
A0A2K5P2T8_BBC3-03      ------------------agcccaattag---------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      gactttttctcaggaggtgcacacttcatcaatttgaagaaagattgcat
A0A2K5NTQ5_BCL2L11      tatggccacca--------------ccacagtcaagatacagaacaactc
A0A2K5NTQ5_BCL2L11      cccttcatagggaagt---------tcagtggccgctcgaatgcttagca
A0A2K5NTQ5_BCL2L11      cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttacta
A0A2K5NTQ5_BCL2L11      tag-----------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttacta
A0A2K5NTQ5_BCL2L11      cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttacta
A0A2K5NTQ5_BCL2L11      cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttacta
A0A2K5NTQ5_BCL2L11      cggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttacta
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       -------------------------------actgctgctggcgctgctc
A0A2K5MJW4_BMF-01       -----------------ggcagatcctcctcttcctgcacaaccttgctt
A0A2K5MJW4_BMF-02       -----------------ggcagatcctcctcttcctgcacaaccttgctt
A0A2K5M0A7_BAD-02       cg--------------------------------gtgggagggctgaccc
A0A2K5M0A7_BAD-01       ggactcctttaagggacttcctcgcccgaagagcgcgggcacagcgacgc
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------ctgctc
A0A2K5P2T8_BBC3-02      acgtcagggactcggggggcaggcccctcccacctcctgacaccctggcc
A0A2K5P2T8_BBC3-01      acgtcagggactcggggggcaggcccctcccacctcctgacaccctggcc
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      tgt-----------------------------------------------
A0A2K5NTQ5_BCL2L11      aac-----------------------------------------------
A0A2K5NTQ5_BCL2L11      tca-----------------------------------------------
A0A2K5NTQ5_BCL2L11      tgc-----------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      tgc-----------------------------------------------
A0A2K5NTQ5_BCL2L11      tgc-----------------------------------------------
A0A2K5NTQ5_BCL2L11      tgc-----------------------------------------------
A0A2K5NTQ5_BCL2L11      tgc-----------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       ag------------------------------------------------
A0A2K5MJW4_BMF-01       tgaatggagaaga-------------------------------------
A0A2K5MJW4_BMF-02       tgaatggagaaga-------------------------------------
A0A2K5M0A7_BAD-02       agattc--------------------------------------------
A0A2K5M0A7_BAD-01       agatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggat
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       ag------------------------------------------------
A0A2K5P2T8_BBC3-02      ag------------------------------------------------
A0A2K5P2T8_BBC3-01      ag------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      ---------------------------------aattgg-----------
A0A2K5NTQ5_BCL2L11      -----------cacaaggatttc----------tcatga-----------
A0A2K5NTQ5_BCL2L11      ---------------------------------agctaa-----------
A0A2K5NTQ5_BCL2L11      -----------aaggaggttg------------gcagaa-----------
A0A2K5NTQ5_BCL2L11      ------------aggaagttgtc----------gtgtag-----------
A0A2K5NTQ5_BCL2L11      ----------------gggtattttt-------gaataa-----------
A0A2K5NTQ5_BCL2L11      -----------aaggagggtattttt-------gaataattaccaagcag
A0A2K5NTQ5_BCL2L11      -----------aaggagggtattttt-------gaataattaccaagcag
A0A2K5NTQ5_BCL2L11      -----------aaggaggatgtcgcttccacctgattaa-----------
A0A2K5NTQ5_BCL2L11      -----------aaggaggttagag---------aaatag-----------
A0A2K5NTQ5_BCL2L11      ---------------------------------gactag-----------
A0A2K5LDM6_BIK-01       -----------cgggggcctgcacctgctgctcaagtga-----------
A0A2K5MJW4_BMF-01       -----------gaacaggaacggggcgggccctag---------------
A0A2K5MJW4_BMF-02       -----------gaacaggaacggggcgggccctaggtga-----------
A0A2K5M0A7_BAD-02       ----------------------ccttccggtgcatgtga-----------
A0A2K5M0A7_BAD-01       cggaacttgggcaggggaagctccgccccctcccagtga-----------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       -----------caggcggaact------------tgtag-----------
A0A2K5P2T8_BBC3-02      -----------cgcgggggactttctctgcaccatgtag-----------
A0A2K5P2T8_BBC3-01      -----------cgcgggggactttctctgcaccatgtag-----------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ------------------------------------ctcctggcatcctc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5NTQ5_BCL2L11      ccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5MJW4_BMF-01       --------------------------------------------------
A0A2K5MJW4_BMF-02       --------------------------------------------------
A0A2K5M0A7_BAD-02       --------------------------------------------------
A0A2K5M0A7_BAD-01       --------------------------------------------------
A0A2K5M0A7_BAD-03       --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A2K5P2T8_BBC3-02      --------------------------------------------------
A0A2K5P2T8_BBC3-01      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      ------------------------
A0A2K5NJZ2_PMAIP1-      ------------------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      cacctga-----------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      cgcctggtgtggagaatgcattga
A0A2K5NTQ5_BCL2L11      cgcctggtgtggagaatgcattga
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5NTQ5_BCL2L11      ------------------------
A0A2K5LDM6_BIK-01       ------------------------
A0A2K5MJW4_BMF-01       ------------------------
A0A2K5MJW4_BMF-02       ------------------------
A0A2K5M0A7_BAD-02       ------------------------
A0A2K5M0A7_BAD-01       ------------------------
A0A2K5M0A7_BAD-03       ------------------------
A0A2K5KZ69_HRK-01       ------------------------
A0A2K5P2T8_BBC3-02      ------------------------
A0A2K5P2T8_BBC3-01      ------------------------
A0A2K5P2T8_BBC3-03      ------------------------
                                                

© 1998-2022Legal notice