Dataset for CDS BCL2L11 of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NTQ5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag

A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NTQ5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta

A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaag--------------------------
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NTQ5_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt

A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NTQ5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc

A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NTQ5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga

A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NTQ5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac

A0A2K5NTQ5_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      ----acaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NTQ5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc

A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtca
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----at
A0A2K5NTQ5_BCL2L11      ------------------------------------------------ct
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----tt
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaat--------
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----ct
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----ct
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----ct
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----ct
A0A2K5NTQ5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg----ct

A0A2K5NTQ5_BCL2L11      ttctggaggatataggtgatagttcattgtggtttggatttatatttact
A0A2K5NTQ5_BCL2L11      -----gag--------------------gccactggatcct---------
A0A2K5NTQ5_BCL2L11      tccaggag--------------------gcaggctgaacctgcagatatg
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      tccaggag--------------------gcaggctgaacctgcagatatg
A0A2K5NTQ5_BCL2L11      tccaggag--------------------gcaggctgaacctgcagatatg
A0A2K5NTQ5_BCL2L11      tccaggag--------------------gcaggctgaacctgcagatatg
A0A2K5NTQ5_BCL2L11      tccaggag--------------------gcaggctgaacctgcagatatg
A0A2K5NTQ5_BCL2L11      aactgg--------------------------------------------

A0A2K5NTQ5_BCL2L11      ggcttagatttgtatggccacca--------------ccacagtcaagat
A0A2K5NTQ5_BCL2L11      ccctcagaattgcccttcatagggaagt---------tcagtggccgctc
A0A2K5NTQ5_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K5NTQ5_BCL2L11      -----agagaaatag-----------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K5NTQ5_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K5NTQ5_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K5NTQ5_BCL2L11      cgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtt
A0A2K5NTQ5_BCL2L11      --------------------------------------------------

A0A2K5NTQ5_BCL2L11      acagaacaactcaaccacaaggatttc----------tcatga-------
A0A2K5NTQ5_BCL2L11      gaatgcttagcatca----------------------agctaa-------
A0A2K5NTQ5_BCL2L11      taacgcttactatgcaaggaggttg------------gcagaa-------
A0A2K5NTQ5_BCL2L11      ----------------aggaagttgtc----------gtgtag-------
A0A2K5NTQ5_BCL2L11      --------------------gggtattttt-------gaataa-------
A0A2K5NTQ5_BCL2L11      taacgcttactatgcaaggagggtattttt-------gaataattaccaa
A0A2K5NTQ5_BCL2L11      taacgcttactatgcaaggagggtattttt-------gaataattaccaa
A0A2K5NTQ5_BCL2L11      taacgcttactatgcaaggaggatgtcgcttccacctgattaa-------
A0A2K5NTQ5_BCL2L11      taacgcttactatgcaaggaggttagag---------aaatag-------
A0A2K5NTQ5_BCL2L11      -------------------------------------gactag-------

A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      ----------------------------------------ctcctggcat
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      gcagccgaagaccacccacaaatggttatcttacgactgttgcgttacat
A0A2K5NTQ5_BCL2L11      gcagccgaagaccacccacaaatggttatcttacgactgttgcgttacat
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------
A0A2K5NTQ5_BCL2L11      --------------------------------------------------

A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      cctccacctga-----------------
A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      tgtccgcctggtgtggagaatgcattga
A0A2K5NTQ5_BCL2L11      tgtccgcctggtgtggagaatgcattga
A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      ----------------------------
A0A2K5NTQ5_BCL2L11      ----------------------------

© 1998-2021Legal notice