Dataset for CDS BCL2L11 of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5NU92_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5NU92_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5NU92_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K5NU92_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5NU92_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **************************************************

A0A2K5NU92_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5NU92_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A2K5NU92_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5NU92_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                        **************************************************

A0A2K5NU92_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5NU92_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A2K5NU92_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5NU92_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A2K5NU92_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
A0A2K5NU92_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgg------
                        ********************************************      

A0A2K5NU92_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaa
A0A2K5NU92_BCL2L11      -----------------gtatttttg------------------------
                                         * *  * **                        

A0A2K5NU92_BCL2L11      gagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
A0A2K5NU92_BCL2L11      --------------------------------------------------
                                                                          

A0A2K5NU92_BCL2L11      agagaaatag
A0A2K5NU92_BCL2L11      -----aataa
                             **** 

© 1998-2020Legal notice