Dataset for CDS BBC3 of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5QNS7_BBC3-03      atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccag
A0A2K5QNS7_BBC3-01      atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccag
A0A2K5QNS7_BBC3-02      atgaaatgtggcgtggggtctgcctgggcatgtccatgccaagtgcccag

A0A2K5QNS7_BBC3-03      ggcttcttcctcggtgtgggttccttgccagatgtgt-------------
A0A2K5QNS7_BBC3-01      ggcttcttcctcggtgtgggttccttgccagatgtgtggccccagggagc
A0A2K5QNS7_BBC3-02      ggcttcttcctcggtgtgggttccttgccagatgtgt-------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cggccgtgtcctgcggcctctgcgagtccggcctgcccgccgcccctgcc
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gcccccgccttgctgcccgctgcctacctctgcgcccccgccaccccacc
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      cgccgtcaccgccgccctggggagcccccgctggcctgggggcccccgca
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gccgcccccgaggcccgcgcccggacggtcctcagccctcgctctcgctg
A0A2K5QNS7_BBC3-02      --------------------------ggtcctcagccctcgctctcgctg

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc
A0A2K5QNS7_BBC3-02      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gggcggtcccacccaggcggccctgggagtccgcggggaggaggagcagt
A0A2K5QNS7_BBC3-02      gggcggtcccacccaggcggccctgggagtccgcggggaggaggagcagt

A0A2K5QNS7_BBC3-03      --------------------------------------------------
A0A2K5QNS7_BBC3-01      gggcccgggagatcggggcccagctgcagcggatggcggacgacctcaac
A0A2K5QNS7_BBC3-02      gggcccgggagatcggggcccagctgcagcggatggcggacgacctcaac

A0A2K5QNS7_BBC3-03      -----------------gagacaagaggagcagccgcagcaccgcccctc
A0A2K5QNS7_BBC3-01      gcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctc
A0A2K5QNS7_BBC3-02      gcgcagtacgagcggcggagacaagaggagcagccgcagcaccgcccctc

A0A2K5QNS7_BBC3-03      gccctggagggtcctgtacaatctcatcatgggactcctgccctttccca
A0A2K5QNS7_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgccctttccca
A0A2K5QNS7_BBC3-02      gccctggagggtcctgtacaatctcatcatgggactcctgccctttccca

A0A2K5QNS7_BBC3-03      ggggccacagagcccccgagatggagcccaattaggtgcctgcacctgcc
A0A2K5QNS7_BBC3-01      ggggccacagagcccccgagatggagcccaattaggtgcctgcacctgcc
A0A2K5QNS7_BBC3-02      ggggccacagagcccccgagatggagcccaattag---------------

A0A2K5QNS7_BBC3-03      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
A0A2K5QNS7_BBC3-01      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
A0A2K5QNS7_BBC3-02      --------------------------------------------------

A0A2K5QNS7_BBC3-03      ctggccagcgcgggggactttctctgcaccatgtag
A0A2K5QNS7_BBC3-01      ctggccagcgcgggggactttctctgcaccatgtag
A0A2K5QNS7_BBC3-02      ------------------------------------

© 1998-2021Legal notice