Dataset for CDS classical BH3-containing proteins of organism Cavia porcellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A286XJN2_BCL2L11      -----------------atggc----------------------------
A0A286XJN2_BCL2L11      -----------------atggc----------------------------
A0A286XJN2_BCL2L11      -----------------atggc----------------------------
A0A286XF37_PMAIP1-      -----------------atgcc----------------------------
H0V608_BAD-01           -----------------atgtt----------------------------
H0W025_BIK-01           -----------------atgtcggaagcaaaac-----------ctgtcg
A0A286XXB0_BMF-02       atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccg
A0A286XXB0_BMF-03       -----------------gtttt----------------------------
                                          *                               

A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
H0W025_BIK-01           ccagggaccc----------------------------------------
A0A286XXB0_BMF-02       ccgcggacccgaccccccccgagtgttcgtcacgctggaccctggcacag
A0A286XXB0_BMF-03       --------------------------------------------------
                                                                          

A0A286XJN2_BCL2L11      ------------------------------------caagcaaccttccg
A0A286XJN2_BCL2L11      ------------------------------------caagcaaccttccg
A0A286XJN2_BCL2L11      ------------------------------------caagcaaccttccg
A0A286XF37_PMAIP1-      --------------------------------------------------
H0V608_BAD-01           ----------------------------------------------cc--
H0W025_BIK-01           ----------------------------------------------actg
A0A286XXB0_BMF-02       agccctggcaccacgactcggaggccgattctctctcctggagtcaccca
A0A286XXB0_BMF-03       ----------------------------------------------ccca
                                                                          

A0A286XJN2_BCL2L11      atgtaag---------ttgtg-----------------agtgtgacagag
A0A286XJN2_BCL2L11      atgtaag---------ttgtg-----------------agtgtgacagag
A0A286XJN2_BCL2L11      atgtaag---------ttgtg-----------------agtgtgacagag
A0A286XF37_PMAIP1-      -tggaaa-------------------------------ggtgtgtaagag
H0V608_BAD-01           ----agatcccagagtttgagcca--------------agtgagcaggaa
H0W025_BIK-01           atggagaccccgctgtttgagccaccccctgggcctctgctggctgaagg
A0A286XXB0_BMF-02       ggggaga---------tggagccacctc----------agtgtgtggagg
A0A286XXB0_BMF-03       agggaga---------tggagccacctc----------agtgtgtggagg
                            *                                   **        

A0A286XJN2_BCL2L11      aaggtggacaattgcagcctgctgagaggccatcccagc----tcagggc
A0A286XJN2_BCL2L11      aaggtggacaattgcagcctgctgagaggccatcccagc----tcagggc
A0A286XJN2_BCL2L11      aaggtggacaattgcagcctgctgagaggccatcccagc----tcagggc
A0A286XF37_PMAIP1-      ---------------cgc-----------gcagccgaactccacgcgggc
H0V608_BAD-01           ---------------gact---------------ccagct-c-tgaagag
H0W025_BIK-01           ---------------ggctttggg----tgtgacgcagccac-tgtgggc
A0A286XXB0_BMF-02       ---------------agctggaggatgatgtgttccaac--c-cgaggat
A0A286XXB0_BMF-03       ---------------agctggaggatgatgtgttccaac--c-cgaggat
                                         *                  * *        *  

A0A286XJN2_BCL2L11      tggg------gccccaacctccctacagacggagccccaaggtaatcctg
A0A286XJN2_BCL2L11      tggg------gccccaacctccctacagacggagccccaaggtaatcctg
A0A286XJN2_BCL2L11      tggg------gccccaacctccctacagacggagcccca-----------
A0A286XF37_PMAIP1-      agagctagaagtt-----------gagtgtgctgccc-------------
H0V608_BAD-01           aggggcctgggccccagccccacaggggac---gagctaggc-------a
H0W025_BIK-01           agagg-----acctcagtccccctggggacactaacctcatg-------g
A0A286XXB0_BMF-02       gggga-----gcc-----------ggggaccc------------------
A0A286XXB0_BMF-03       gggga-----gcc-----------ggggaccc------------------
                         * *                                              

A0A286XJN2_BCL2L11      aaggcgcaggggaccgctccccccacggca------gccctcagggcccg
A0A286XJN2_BCL2L11      aaggcgcaggggaccgctccccccacggca------gccctcagggcccg
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      --agctcaggagag------ttggag----------acacactgaattcc
H0V608_BAD-01           gcagcccagcaggaggcttcctgggggacaccagtcaccagcagaggcag
H0W025_BIK-01           aatgcgtggaaggcagcagcctggtg----------gcc--ctg---cgg
A0A286XXB0_BMF-02       --agcctgggagcctgctctctgctgatctct--ttgcc--cagagccag
A0A286XXB0_BMF-03       --agcctgggagcctgctctctgctgatctct--ttgcc--cagagccag
                                                                          

A0A286XJN2_BCL2L11      ctggccccaccggccagtcctggcccttttgctaccagatccccgctatt
A0A286XJN2_BCL2L11      ctggccccaccggccagtcctggcccttttgctaccagatccccgctatt
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      ctgg----------------------------------------------
H0V608_BAD-01           ctga----------------------------------------------
H0W025_BIK-01           ctgg----------------------------------------------
A0A286XXB0_BMF-02       ctgg----------------------------------------------
A0A286XXB0_BMF-03       ctgg----------------------------------------------
                                                                          

A0A286XJN2_BCL2L11      catctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatt
A0A286XJN2_BCL2L11      catctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatt
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XF37_PMAIP1-      ---------------------gttgcaccacggagg-ccttggaggtgct
H0V608_BAD-01           ---------------------gaagcagcaggagccaccatggaggcact
H0W025_BIK-01           ---------------------cctgcatcggtgacg-----agatggacc
A0A286XXB0_BMF-02       ---------------------actgtccccttggtc-----ggctgcacc
A0A286XXB0_BMF-03       ---------------------actgtccccttggtc-----ggctgcacc
                                                                          

A0A286XJN2_BCL2L11      tctcttttgacacagac----aggagcccggcac-----ccatgagtt--
A0A286XJN2_BCL2L11      tctcttttgacacagac----aggagcccggcac-----ccatgagtt--
A0A286XJN2_BCL2L11      -------------agac----aggagcccggcac-----ccatgagtt--
A0A286XF37_PMAIP1-      t--------gcagagat-------------ggct----------------
H0V608_BAD-01           ---------gtggctat----ggagacccggagt---cgccaccggtctt
H0W025_BIK-01           t--------gcgcctac----ggagcccccgcct--ggcccagctgcc--
A0A286XXB0_BMF-02       tctttcctctcacccactgctgtggccctgggcttcgccccaccagcc--
A0A286XXB0_BMF-03       tctttcctctcacccactgctgtggccctgggcttcgccccaccagcc--
                                       *              *                   

A0A286XJN2_BCL2L11      ---------------------gtgacaaatcaacacaaaccccaagtcc-
A0A286XJN2_BCL2L11      ---------------------gtgacaaatcaacacaaaccccaagtcc-
A0A286XJN2_BCL2L11      ---------------------gtgacaaatcaacacaaaccccaagtcc-
A0A286XF37_PMAIP1-      ------------------gggaagaaggcgcgg---aagagctcgg----
H0V608_BAD-01           atcctgcagggactgaggaggaggaagggatggaggaggagctcagtcca
H0W025_BIK-01           ------------------agggag----ggcagtgcacagcct--ggcca
A0A286XXB0_BMF-02       ------------------aggaagacaaggccactcagaccctcagccca
A0A286XXB0_BMF-03       ------------------aggaagacaaggccactcagaccctcagccca
                                               *            *    *   *    

A0A286XJN2_BCL2L11      -----tccttgccaggccttcaaccattatctcagtgcaatggcttccat
A0A286XJN2_BCL2L11      -----tccttgccaggccttcaaccattatctcagtgcaatggcttccat
A0A286XJN2_BCL2L11      -----tccttgccaggccttcaaccattatctcagtgcaatggcttccat
A0A286XF37_PMAIP1-      ---------agccgg------a--------tccggcac--gggcgcgcgc
H0V608_BAD-01           tt---------ccggg---------------gccgctc------gcgctc
H0W025_BIK-01           tcacttac-agccag------a--------tggggctctggggtgtgctc
A0A286XXB0_BMF-02       tcctctccaagccagggtgtca--------tgctgccttgtggggtgact
A0A286XXB0_BMF-03       tcctctccaagccagggtgtca--------tgctgccttgtggggtgact
                                   ** *                   *               

A0A286XJN2_BCL2L11      gaggcagtct-----------------caggctggacctccgcatt----
A0A286XJN2_BCL2L11      gaggcagtct-----------------caggctggacctccgcatt----
A0A286XJN2_BCL2L11      gaggcagtct-----------------caggctggacctccgcatt----
A0A286XF37_PMAIP1-      gg---------------------------agctggaagtcgagtgt----
H0V608_BAD-01           gg------------------------------cgccacccaacctc--tg
H0W025_BIK-01           gg-------------------------aaggctgaccctcagtctc----
A0A286XXB0_BMF-02       gaggaaccccagcgactcttttatggcaatgctggctaccggcttcctct
A0A286XXB0_BMF-03       gaggaaccccagcgactcttttatggcaatgctggctaccggcttcctct
                        *                                *     *          

A0A286XJN2_BCL2L11      -tgcgcccag----------------------agatatggatcgcacagg
A0A286XJN2_BCL2L11      -tgcgcccag----------------------agatatggatcgcacagg
A0A286XJN2_BCL2L11      -tgcgcccag----------------------agatatggatcgcacagg
A0A286XF37_PMAIP1-      -gctgctcag-------------------ttgagaaga------attgga
H0V608_BAD-01           ggctgcacag---cgctacggccgagagctccggaggatgagcgac----
H0W025_BIK-01           ----gc-cag------------------cctcag-gga----caatgtgt
A0A286XXB0_BMF-02       ccctgc-cagtttccctgcaggcttgccccttgg-ggagcagccccctga
A0A286XXB0_BMF-03       ccctgc-cagtttccctgcaggcttgccccttgg-ggagcagccccctga
                            ** ***                       *                

A0A286XJN2_BCL2L11      aattgcgtcg-------catcggagatga--------------gtttaat
A0A286XJN2_BCL2L11      aattgcgtcg-------catcggagatga--------------gtttaat
A0A286XJN2_BCL2L11      aattgcgtcg-------catcggagatga--------------gtttaat
A0A286XF37_PMAIP1-      gataaactga--atttccagcagaaa-----------------cttatgt
H0V608_BAD-01           gagttcgtgg--ac-tccttcaagggt----------------cttcctc
H0W025_BIK-01           gggcctgtgg--acgcccagc----------------------ctcccgt
A0A286XXB0_BMF-02       aggtcagtggcaacatcgagcagaggtacagatcgcccggaagcttcagt
A0A286XXB0_BMF-03       aggtcagtggcaacatcgagcagaggtacagatcgcccggaagcttcagt
                               *            *                       *     

A0A286XJN2_BCL2L11      gcctcgtacccaaggcg------------------ggtgttcttgaatca
A0A286XJN2_BCL2L11      gcctcgtacccaaggcg------------------ggtgttcttgaatca
A0A286XJN2_BCL2L11      gcctcgtacccaaggcg------------------ggtgttcttgaatca
A0A286XF37_PMAIP1-      atttgatttccaaactc---------------------------------
H0V608_BAD-01           gcccgaagagcgcgggcacagcgac----------gaagctgtggcagaa
H0W025_BIK-01           gcctgg-----gtgtcc-ccccg---------------------------
A0A286XXB0_BMF-02       gcattgcagaccagttc-caccgacttcacattcaacaacaccaacagaa
A0A286XXB0_BMF-03       gcattgcagaccagttc-caccgacttcacattcaacaacaccaacagaa
                                                                          

A0A286XJN2_BCL2L11      ttaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttac
A0A286XJN2_BCL2L11      ttaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttac
A0A286XJN2_BCL2L11      ttaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttac
A0A286XF37_PMAIP1-      -----------------atcagtttg------------------------
H0V608_BAD-01           ctctaattggacacgg-gccatccagtcctggtgggatcggaacttgggg
H0W025_BIK-01           ctggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgctgc
A0A286XXB0_BMF-02       ccggaatcgcgcatggtggcag---gtcttactcttcatgc---------
A0A286XXB0_BMF-03       ccggaatcgcgcatggtggcag---gtcttactcttcatgc---------
                                           *                              

A0A286XJN2_BCL2L11      gttacattatccgcctggtatggcgaatgcat------------------
A0A286XJN2_BCL2L11      gttacattatccgcctggtatggcgaatgcat------------------
A0A286XJN2_BCL2L11      gttacattatccgcctggtatggcgaatgcat------------------
A0A286XF37_PMAIP1-      ---gtaacc-----------------------------------------
H0V608_BAD-01           agaggaggctccgccc---------------cctcccaggagtcggtc--
H0W025_BIK-01           tggggaccctgcgcct-------------------------gctgctgc-
A0A286XXB0_BMF-02       ---acaacctgggtctgaacggagaagagaacagggaaggggcaggtccc
A0A286XXB0_BMF-03       ---acaacctgggtctgaacggagaagagaacagggaaggggcaggtccc
                             *                                            

A0A286XJN2_BCL2L11      ---tga
A0A286XJN2_BCL2L11      ---tga
A0A286XJN2_BCL2L11      ---tga
A0A286XF37_PMAIP1-      ---tga
H0V608_BAD-01           ---tga
H0W025_BIK-01           -agtga
A0A286XXB0_BMF-02       aggtga
A0A286XXB0_BMF-03       aggtga
                           ***

© 1998-2020Legal notice