Dataset for CDS BCL2L11 of organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3X5Q0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C3X5Q0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C3X5Q0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C3X5Q0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C3X5Q0_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A8C3X5Q0_BCL2L11      acagttgcagcctgccgagaggcctcctcagctcaggcctggggccccca
A0A8C3X5Q0_BCL2L11      acagttgcagcctgccgagaggcctcctcagctcaggcctggggccccca
A0A8C3X5Q0_BCL2L11      acagttgcagcctgccgagaggcctcctcagctcaggcctggggccccca
A0A8C3X5Q0_BCL2L11      acagttgcagcctgccgagaggcctcctcagctcaggcctggggccccca
A0A8C3X5Q0_BCL2L11      acagttgcagcctgccgagaggcctcctcagctcaggcctggggccccca
                        **************************************************

A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaa---------------------------
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgc
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgc
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgc
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggca----------------------------
                        **********************                            

A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      tgcccccaaggcagcccccagggcccgctggccccaccggccagccctgg
A0A8C3X5Q0_BCL2L11      tgcccccaaggcagcccccagggcccgctggccccaccggccagccctgg
A0A8C3X5Q0_BCL2L11      tgcccccaaggcagcccccagggcccgctggccccaccggccagccctgg
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      cccctttgccaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A8C3X5Q0_BCL2L11      cccctttgccaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A8C3X5Q0_BCL2L11      cccctttgccaccagatccccgcttttcatcttcgtgagaagatcttccc
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C3X5Q0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C3X5Q0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C3X5Q0_BCL2L11      ----------------------------------------agacaggagc
                                                                          

A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      ccagcacccatgagttgtgacaaatcgacacaaaccccaagtcctccttg
A0A8C3X5Q0_BCL2L11      ccagcacccatgagttgtgacaaatcgacacaaaccccaagtcctccttg
A0A8C3X5Q0_BCL2L11      ccagcacccatgagttgtgacaaatcgacacaaaccccaagtcctccttg
A0A8C3X5Q0_BCL2L11      ccagcacccatgagttgtgacaaatcgacacaaaccccaagtcctccttg
                                                                          

A0A8C3X5Q0_BCL2L11      -------------------------------gcttccatgaggcagtctc
A0A8C3X5Q0_BCL2L11      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A8C3X5Q0_BCL2L11      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A8C3X5Q0_BCL2L11      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
A0A8C3X5Q0_BCL2L11      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
                                                       *******************

A0A8C3X5Q0_BCL2L11      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
A0A8C3X5Q0_BCL2L11      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
A0A8C3X5Q0_BCL2L11      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
A0A8C3X5Q0_BCL2L11      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
A0A8C3X5Q0_BCL2L11      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
                        **************************************************

A0A8C3X5Q0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaagaaggct------
A0A8C3X5Q0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaagaagggg------
A0A8C3X5Q0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaagaaggtt------
A0A8C3X5Q0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaagaagggtctttct
A0A8C3X5Q0_BCL2L11      cggcgtattggagacgaatttaatgcatattacccaagaagggtctttct
                        ******************************************        

A0A8C3X5Q0_BCL2L11      ggcagaatgcctggcattctgcacc-------------------------
A0A8C3X5Q0_BCL2L11      ------ttactgtgtgtgcgagaacc------------------------
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      gaataattaccaagcagccgaagcccacccgcaaatggttatcttacgac
A0A8C3X5Q0_BCL2L11      gaataattaccaagcagccgaagcccacccgcaaatggttatcttacgac
                                                                          

A0A8C3X5Q0_BCL2L11      --------------------------------------tga
A0A8C3X5Q0_BCL2L11      ----------cagcttcttgctggaccaggagagac--tga
A0A8C3X5Q0_BCL2L11      -------------------------------agagcagtag
A0A8C3X5Q0_BCL2L11      tgttgcgctacatcgtccgtctggtgtggaggatgcagtga
A0A8C3X5Q0_BCL2L11      tgttgcgctacatcgtccgtctggtgtggaggatgcagtga
                                                              *  

© 1998-2022Legal notice