Dataset for CDS BBC3 of organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3WID6_BBC3-01      -----------atggcccgagcacgccaggagggcagctccccggagccc
A0A8C3WID6_BBC3-02      ggatccgaccggcggcctgag-acgcggcgcaagccacatgc--gagc--
                                     **** *** ****   *   **  *   *  ****  

A0A8C3WID6_BBC3-01      gtagagggcctagc--ccgcgacggcccgcgtcccttccccctcagccgc
A0A8C3WID6_BBC3-02      ---gggcgcctggcggcggcggcggcggcggcaacaaaatcatcggcagc
                           * * **** **  * *** ****    *   *     * ** ** **

A0A8C3WID6_BBC3-01      ctggtgcc-----ctctgccgtgtcctgcggcctctgcgaacccggtctg
A0A8C3WID6_BBC3-02      --ggtggccaggacgcggacgcg-cctgtgg--ttcgaggagcagccgcg
                          **** *     * * * ** * **** **  *  * * * * *    *

A0A8C3WID6_BBC3-01      cctgccgcccccgccgcccctacc-ctgctgcc----cgccgcctacctc
A0A8C3WID6_BBC3-02      gcaacaacagcaacagcagcagtcactgcagttagagcagcagcagcagc
                         *  *  *  *  * **  *   * **** *      *  *  *  *  *

A0A8C3WID6_BBC3-01      tgc-gcccctaccgccccacccgccgtcaccgctgc--------cctggg
A0A8C3WID6_BBC3-02      agcggccgccaccgcagcagcagccgccgccgcagcgagcggcgctcagc
                         ** *** * *****  ** * **** * **** **        *   * 

A0A8C3WID6_BBC3-01      gggc---ccccgctg------gccagggggtccccgcagccggccccg--
A0A8C3WID6_BBC3-02      gggcgcgccctcctgaaggaagccgcccgccccccatcaccgtcccctcc
                        ****   ***  ***      ***    *  ****    *** ****   

A0A8C3WID6_BBC3-01      ---aggcccgcgacccgacggtcctcagccctcactctcgcccgcggagc
A0A8C3WID6_BBC3-02      ggcgtgttcatgcccccggggtcctcagccctcactctcgcccgcggagc
                             *  *  * ***   *******************************

A0A8C3WID6_BBC3-01      agcacctggaatcgccggtgcccagcgctccgggggccctggcgggcggc
A0A8C3WID6_BBC3-02      agcacctggaatcgccggtgcccagcgctccgggggccctggcgggcggc
                        **************************************************

A0A8C3WID6_BBC3-01      cccacccaagcggccccgggagtccggggggaggaggagcagtgggcccg
A0A8C3WID6_BBC3-02      cccacccaagcggccccgggagtccggggggaggaggagcagtgggcccg
                        **************************************************

A0A8C3WID6_BBC3-01      agagatcggggcccagctgcggcggatggctgacgacctcaacgcgctgt
A0A8C3WID6_BBC3-02      agagatcggggcccagctgcggcggatggctgacgacctcaacgcgctgt
                        **************************************************

A0A8C3WID6_BBC3-01      acgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctgg
A0A8C3WID6_BBC3-02      acgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctgg
                        **************************************************

A0A8C3WID6_BBC3-01      agggtcctgtacaatctcatcatgggactcctgcccttacccagggaccg
A0A8C3WID6_BBC3-02      agggtcctgtacaatctcatcatgggactcctgcccttacccagggaccg
                        **************************************************

A0A8C3WID6_BBC3-01      tggagccccggagatggagcctaattag
A0A8C3WID6_BBC3-02      tggagccccggagatggagcctaattag
                        ****************************

© 1998-2022Legal notice