Dataset for CDS BBC3 of organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      atgaaattgagtgtgggggctgcccgggcatgttcgtgccaggtgcccag
                                                                          

A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ggttgcctcctgtgggtgggcccacgccctatttgtgtggagcctggcta
                                                                          

A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ggtgtgcacagtctggagtatgtcctgccagtgggccagttagcaggaac
                                                                          

A0A250YBU3_BBC3-02      ------------------------atggcccgcgcacgccaggagggcag
A0A250YBU3_BBC3-01      ctgtcacaggccccagggagcgccatggcccgcgcacgccaggagggcag
                                                **************************

A0A250YBU3_BBC3-02      ctctccggagcccgtagagggcttagctcgcgacggcccgcgccccttcc
A0A250YBU3_BBC3-01      ctctccggagcccgtagagggcttagctcgcgacggcccgcgccccttcc
                        **************************************************

A0A250YBU3_BBC3-02      cgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccg
A0A250YBU3_BBC3-01      cgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagccg
                        **************************************************

A0A250YBU3_BBC3-02      ggcctgcccgccgccccagccgccccggccctgctgcccgccgcctacct
A0A250YBU3_BBC3-01      ggcctgcccgccgccccagccgccccggccctgctgcccgccgcctacct
                        **************************************************

A0A250YBU3_BBC3-02      ctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggccccc
A0A250YBU3_BBC3-01      ctgcgcccccaccgccccgcccgccgtcaccgcagccttggggggccccc
                        **************************************************

A0A250YBU3_BBC3-02      gctggcctggaggtccccgcagccggccccgaggcccgcgtccggatggt
A0A250YBU3_BBC3-01      gctggcctggaggtccccgcagccggccccgaggcccgcgtccggatggt
                        **************************************************

A0A250YBU3_BBC3-02      cctcagccatcactatcaccagcccagcagcacctagagtcacccgtgcc
A0A250YBU3_BBC3-01      cctcagccatcactatcaccagcccagcagcacctagagtcacccgtgcc
                        **************************************************

A0A250YBU3_BBC3-02      cagcgtcccggaggccctggcgggcggccccacccaggcggcccccggag
A0A250YBU3_BBC3-01      cagcgtcccggaggccctggcgggcggccccacccaggcggcccccggag
                        **************************************************

A0A250YBU3_BBC3-02      tccggggggaggaggagcagtgggcccgggagatcggggcccagctgcgg
A0A250YBU3_BBC3-01      tccggggggaggaggagcagtgggcccgggagatcggggcccagctgcgg
                        **************************************************

A0A250YBU3_BBC3-02      cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaaga
A0A250YBU3_BBC3-01      cggatggcggacgacctcaacgcgcagtacgagcggcggagacaagaaga
                        **************************************************

A0A250YBU3_BBC3-02      gcaacagcaacaccgcccctcgccctggagggtgctgtacaatgtcatca
A0A250YBU3_BBC3-01      gcaacagcaacaccgcccctcgccctggagggtgctgtacaatgtcatca
                        **************************************************

A0A250YBU3_BBC3-02      tgggactcctgcccttacccaggggcccgggagccccggagatggagccc
A0A250YBU3_BBC3-01      tgggactcctgcccttacccaggggcccgggagccccggagatggagccc
                        **************************************************

A0A250YBU3_BBC3-02      aattag
A0A250YBU3_BBC3-01      aattag
                        ******

© 1998-2020Legal notice