Dataset for CDS classical BH3-containing proteins of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A452EST2_PMAIP1-      at------------------------------------------------
A0A452FCR6_BCL2L11      atgg----------------------------------------------
A0A452FCR6_BCL2L11      atgg----------------------------------------------
A0A452DXE5_HRK-01       atg-----------------------------------------------
A0A452E3G1_BBC3-01      atg-----------------------------------------------
A0A452F2E0_BMF-01       atggagccaccccag-----------------------------------
A0A452F2E0_BMF-02       atggagccaccccag-----------------------------------
A0A452ER54_BAD-02       --------------------------------------------------
A0A452ER54_BAD-01       atggggaccccggagaatccctcagcggctcccacaactcggaagctgag

A0A452EST2_PMAIP1-      --------------------------------------------------
A0A452FCR6_BCL2L11      ----------------------------------caaagcaaccttccga
A0A452FCR6_BCL2L11      ----------------------------------caaagcaaccttccga
A0A452DXE5_HRK-01       --------------------------------------------------
A0A452E3G1_BBC3-01      ----------------------------------gcccgagcacgccagg
A0A452F2E0_BMF-01       ----------------------------------tgtgtggaggagctgg
A0A452F2E0_BMF-02       ----------------------------------tgtgtggaggagctgg
A0A452ER54_BAD-02       ----------------------------------tatcgggcttgggccc
A0A452ER54_BAD-01       catccggagacgtagaagagaatcaggaggaaggcagtgggcggggcccc

A0A452EST2_PMAIP1-      ---------------------------------------gcctggaagga
A0A452FCR6_BCL2L11      tgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaga
A0A452FCR6_BCL2L11      tgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgaga
A0A452DXE5_HRK-01       -----------------------------------------tgcccgtgc
A0A452E3G1_BBC3-01      agggcagctcccccgagcccgtagagggcctggcccgcgacggcccgcgc
A0A452F2E0_BMF-01       aggatgacgtattccag---ccagaggatgggga---------accaggg
A0A452F2E0_BMF-02       aggatgacgtattccag---ccagaggatgggga---------accaggg
A0A452ER54_BAD-02       ag---agcatgttccagatcccagagtttgagcagag----tgagcagga
A0A452ER54_BAD-01       ggggaagcatgttccagatcccagagtttgagcagag----tgagcagga

A0A452EST2_PMAIP1-      gggctcgt-----------aggagcgcccagcc-----------------
A0A452FCR6_BCL2L11      ggcctcctcagctcagaccaggggcccccacctctttacagacagagcgg
A0A452FCR6_BCL2L11      ggcctcctcagctcagaccaggggcccccacctctttacagacagagcgg
A0A452DXE5_HRK-01       cc---cctgcaccgcggccgtggccccccggccgtgtgc-----------
A0A452E3G1_BBC3-01      cccttcccgctcagccgcctggtgccctcggcggtgtcctgtggcctctg
A0A452F2E0_BMF-01       g---cccagcccaggaggttgctctctgctgacctgtttgcccagagcca
A0A452F2E0_BMF-02       g---cccagcccaggaggttgctctctgctgacctgtttgcccagagcca
A0A452ER54_BAD-02       agactccagccctgcagataggggcctgggccccagccccacaggggaca
A0A452ER54_BAD-01       agactccagccctgcagataggggcctgggccccagccccacaggggaca

A0A452EST2_PMAIP1-      --------------------------------------------------
A0A452FCR6_BCL2L11      caaggtaatcctgaaggagaaggggaccgctgcccccaaggcagcccgca
A0A452FCR6_BCL2L11      ca------------------------------------------------
A0A452DXE5_HRK-01       ------------gcctgca--------------gc---------------
A0A452E3G1_BBC3-01      cgaacccggcctgcctgct--------------gcccccgccgcccccgc
A0A452F2E0_BMF-01       g----ctggactgcc------------------ccctcagccgcct----
A0A452F2E0_BMF-02       g----ctggactgcc------------------ccctcagccgcct----
A0A452ER54_BAD-02       ggcccccaggtctcagcaagcactggctaacagccccgggcctcctgggg
A0A452ER54_BAD-01       ggcccccaggtctca------------------ccccgggcctcctgggg

A0A452EST2_PMAIP1-      --------------------------------------------------
A0A452FCR6_BCL2L11      gggcccgctggccccaccggccagccccggcc-----ctttcgctaccag
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452DXE5_HRK-01       ------gccggccgtctgggtctgc----gct-----cgtccgccgcgca
A0A452E3G1_BBC3-01      cctgctgcccgccgcctacctctgc----gcc-----c--ccaccgcccc
A0A452F2E0_BMF-01       gcagctcttccctctcacgcactgctgtggccctgggcttcgacccacca
A0A452F2E0_BMF-02       gcagctcttccctctcacgcactgctgtggccctgggcttcgacccacca
A0A452ER54_BAD-02       gaagctggtcaccagcaggggcagc--cggcc---ggcagcagcc-----
A0A452ER54_BAD-01       gaagctggtcaccagcaggggcagc--cggcc---ggcagcagcc-----

A0A452EST2_PMAIP1-      --------------------------------------------------
A0A452FCR6_BCL2L11      atccccgctcttcatcttcgtgagaagatcctccttgctgtctcggtcct
A0A452FCR6_BCL2L11      --------------------------------------------------
A0A452DXE5_HRK-01       gc-------tcacggccgccc---------------ggctcaaggcgctc
A0A452E3G1_BBC3-01      gcc-cgccgtcactgccgccctgggggccccccgctggcctgggggtccc
A0A452F2E0_BMF-01       gccaggaagaca---aggctacccagactc----tcagcccagcttcccc
A0A452F2E0_BMF-02       gccaggaagaca---aggctacccagactc----tcagcccagcttcccc
A0A452ER54_BAD-02       accatggaggcactggggctgtggagacccggagtcgtcacagctcctac
A0A452ER54_BAD-01       accatggaggcactggggctgtggagacccggagtcgtcacagctcctac

A0A452EST2_PMAIP1-      -------------------------------gagcc--------------
A0A452FCR6_BCL2L11      ccagcgggtatttctcttttgacacagacaggagcccggcacccatgagt
A0A452FCR6_BCL2L11      -------------------------agacaggagcccggcacccatgagt
A0A452DXE5_HRK-01       ggcgac-------------------------gagctgcaccagcgcacca
A0A452E3G1_BBC3-01      cgcagc-------------------------cggccccg-aggcccgcga
A0A452F2E0_BMF-01       -------------------------------gagccagggtgtcatgctg
A0A452F2E0_BMF-02       -------------------------------gagccagggtgtcatgctg
A0A452ER54_BAD-02       cccgcg-------------------------gggccagaggatgatg---
A0A452ER54_BAD-01       cccgcg-------------------------gggccagaggatgatg---

A0A452EST2_PMAIP1-      ----------c------------------cacgcgg--------------
A0A452FCR6_BCL2L11      tgtgacaaatc------------------cacacag--------------
A0A452FCR6_BCL2L11      tgtgacaaatc------------------cacacag--------------
A0A452DXE5_HRK-01       tgtggcggcgc--------------cgcgcgcggag-----cc-------
A0A452E3G1_BBC3-01      cccgacggtcctcagccttcactctcgcccgcggagcagcacc-------
A0A452F2E0_BMF-01       ccttgtggggt------------------gactgaggagccccagcgact
A0A452F2E0_BMF-02       ccttgtggggt------------------gactgaggagccccagcgact
A0A452ER54_BAD-02       ----aagggac------------------ggaggaggaggatc-tcggcc
A0A452ER54_BAD-01       ----aagggac------------------ggaggaggaggatc-tcggcc

A0A452EST2_PMAIP1-      ----------gtcccg----------------------------------
A0A452FCR6_BCL2L11      ----------accccaagccctccttgccaggccttcaaccattatctca
A0A452FCR6_BCL2L11      ----------accccaagccctccttgccaggccttcaaccattatctca
A0A452DXE5_HRK-01       ------ggagggcgccggcgcccggcgcgct-------------------
A0A452E3G1_BBC3-01      ------tggaatcgccagtgcccagcgccccg------------------
A0A452F2E0_BMF-01       cttttatggcaatgctggctaccggctcccccttcctgccagtttccctg
A0A452F2E0_BMF-02       cttttatggcaatgctggctaccggctcccccttcctgccagtttccctg
A0A452ER54_BAD-02       cctttaggg-gccgctcgcgttcggcgccccc------------------
A0A452ER54_BAD-01       cctttaggg-gccgctcgcgttcggcgccccc------------------

A0A452EST2_PMAIP1-      --------------------------------------gcagat------
A0A452FCR6_BCL2L11      gtgcaatggcttccatgaggcagtctcaggctgtacctgcagatacacgc
A0A452FCR6_BCL2L11      gtgcaatggcttccatgaggcagtctcaggctgtacctgcagatacacgc
A0A452DXE5_HRK-01       ----------------------ccctacctactggccctgg---------
A0A452E3G1_BBC3-01      ----ggggccctggcgggcggacccacccaagcggccccgggagtccggg
A0A452F2E0_BMF-01       caggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcga
A0A452F2E0_BMF-02       caggcttgccccttggtgagcaaccccctgaagggcagtggcaacatcga
A0A452ER54_BAD-02       --------------------caacctct----gggc-----------tgc
A0A452ER54_BAD-01       --------------------caacctct----gggc-----------tgc

A0A452EST2_PMAIP1-      cctgaagttgagtgtgccattc--------------agttgaggagaatt
A0A452FCR6_BCL2L11      ccagagatatggattgcccaag--------------agctacggcgtatc
A0A452FCR6_BCL2L11      ccagagatatggattgcccaag--------------agctacggcgtatc
A0A452DXE5_HRK-01       ----------------------------ctgtgcgcggccgc-gcaggtg
A0A452E3G1_BBC3-01      gggaggaggagcagtgggcccgagagatcggggcccagctgcggcggatg
A0A452F2E0_BMF-01       gcagagatacagattgcccgaa--------------aactccagtgcatt
A0A452F2E0_BMF-02       gcagagatacagattgcccgaa--------------aactccagtgcatt
A0A452ER54_BAD-02       acagcgata-----tggccgcg--------------agctccgaaggatg
A0A452ER54_BAD-01       acagcgata-----tggccgcg--------------agctccgaaggatg

A0A452EST2_PMAIP1-      ggagacaaactgaat-----ttccggcagaaa----cttg----------
A0A452FCR6_BCL2L11      ggagacgagtttaatgcgtattacccaagaagggtcttcg----------
A0A452FCR6_BCL2L11      ggagacgagtttaatgcgtattacccaagaagggtcttcg----------
A0A452DXE5_HRK-01       gcg--------------gcgct--------ggcgg---------------
A0A452E3G1_BBC3-01      gcggacgacctcaa--cgcgctatacgagcggcggagaca----agagga
A0A452F2E0_BMF-01       gcagaccagttccat-cggcttcat-atgcagcaacatca----------
A0A452F2E0_BMF-02       gcagaccagttccat-cggcttcat-atgcagcaacatca----------
A0A452ER54_BAD-02       agcgacgagtttca--cgtctccttcaaggggcttcctcgcccgaagagc
A0A452ER54_BAD-01       agcgacgagtttca--cgtctccttcaaggggcttcctcgcccgaagagc

A0A452EST2_PMAIP1-      --------tgaatc----------tgatagc------caaa-----ctcc
A0A452FCR6_BCL2L11      --------tgcgtcaccaggcgattgagggccacccacaaatggtcctcc
A0A452FCR6_BCL2L11      --------tgcgtcaccaggcgattgagggccacccacaaatggtcctcc
A0A452DXE5_HRK-01       -----------------------cctgg----------------------
A0A452E3G1_BBC3-01      gcggcaacgacaccgcccctcgccctggagggtcctgtacaatctcatct
A0A452F2E0_BMF-01       gcagaaccgaaatcgcatgtggtggcagatcctc---------ctcttcc
A0A452F2E0_BMF-02       gcagaaccgaaatcgcatgtggtggcagatcctc---------ctcttcc
A0A452ER54_BAD-02       gcgggaacggcaacgcaaat-gcgacaaagccctagctggacgcgcttcc
A0A452ER54_BAD-01       gcgggaacggcaacgcaaat-gcgacaaagccctagctggacgcgcttcc

A0A452EST2_PMAIP1-      tccgc-tcaggaact-----------------------------------
A0A452FCR6_BCL2L11      tgcgcgtcttgcgct--------acctggtgcgtctggtgtggaggatgc
A0A452FCR6_BCL2L11      tgcgcgtcttgcgct--------acctggtgcgtctggtgtggaggatgc
A0A452DXE5_HRK-01       --------ctgctc---------ggc-------------aggcggaactt
A0A452E3G1_BBC3-01      tgggactcctgcccttccccgggggccgcggagcccccgaggtggagccc
A0A452F2E0_BMF-01       tgcacaacgtggctttgaatggagatgagaacaggaatggggcaggcccc
A0A452F2E0_BMF-02       tgcacaacgtggctttgaatggagatgagaacaggaatggggcaggcccc
A0A452ER54_BAD-02       tcca-gtcctggtt-------gagccg-gaacttggggaggggaggctcc
A0A452ER54_BAD-01       tcca-gtcctggtt-------gagccg-gaacttggggaggggaggctcc

A0A452EST2_PMAIP1-      ------------tga
A0A452FCR6_BCL2L11      a----------gtga
A0A452FCR6_BCL2L11      a----------gtga
A0A452DXE5_HRK-01       g-----------tag
A0A452E3G1_BBC3-01      a---------attag
A0A452F2E0_BMF-01       a---------ggtga
A0A452F2E0_BMF-02       a---------ggtga
A0A452ER54_BAD-02       gccccctcccagtga
A0A452ER54_BAD-01       gccccctcccagtga

© 1998-2020Legal notice