Dataset for CDS PMAIP1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F4CR18_PMAIP1-      ---ccagcacgggcggctcgggaccagcacgga-cctgggccgggaggcg
Q1PCT2_PMAIP1-01        atgcccggccggaaggcgcgcaa-gagcgcgcagcccggccccacgcggg
                           ** *  ***  *** **  *  *** ** * ** ** **     * *

A0A5F4CR18_PMAIP1-      cccctaaacaacttagttttgagtgcgagatt----------actttaga
Q1PCT2_PMAIP1-01        cccccgaagagctcgaagtggagtgtgccattcagctcaggaaatttgga
                        ****  ** * **     * ***** *  ***          * *** **

A0A5F4CR18_PMAIP1-      aaaataccacccatttataaccacaaaaaaaaaaatgataaatatgctct
Q1PCT2_PMAIP1-01        gacaaactg--aatttccggc--------agaaacttctgaatctgttat
                         * * **     ****    *        * *** *  * *** ** * *

A0A5F4CR18_PMAIP1-      ctcaagtcctcagaaatggcaaatga
Q1PCT2_PMAIP1-01        ccaaactcttccgctcaggaacctga
                        *  ** ** ** *    ** *  ***

© 1998-2020Legal notice